 IMMUNOGENIC COMPOSITIONS
专利摘要:
This invention relates to immunogenic compositions, particularly vaccine compositions, for use in providing protection against disease caused by bacterial infection with Shigella strains. 公开号:BE1024284B1 申请号:E2016/5444 申请日:2016-06-15 公开日:2018-01-15 发明作者:Christiane Gerke；Laura Bartle Martin；Allan James Saul 申请人:Glaxosmithkline Biologicals Sa； IPC主号:
专利说明:
(30) Priority data: 06/16/2015 EP 15020097.0 (73) Holder (s): GLAXOSMITHKLINE BIOLOGICALS SA 1330, RIXENSART Belgium (72) Inventor (s): GERKE Christiane 53100 SIENA Italy MARTIN Laura Bartle 53100 SIENA Italy SAULAIIan James 53100 SIENA Italy (54) IMMUNOGENIC COMPOSITIONS (57) This invention relates to immunogenic compositions, particularly vaccine compositions, for use in providing protection against disease caused by bacterial infection with Shigella strains. 0.6-, Time after injection (hours) Figure 1 BELGIAN INVENTION PATENT FPS Economy, SMEs, Middle Classes & Energy Publication number: 1024284 Deposit number: BE2016 / 5444 Intellectual Property Office International Classification: A61K 39/112 A61K 39/00 Date of issue: 01/15/2018 The Minister of the Economy, Having regard to the Paris Convention of March 20, 1883 for the Protection of Industrial Property; Considering the law of March 28, 1984 on patents for invention, article 22, for patent applications introduced before September 22, 2014; Considering Title 1 “Patents for invention” of Book XI of the Code of Economic Law, article XI.24, for patent applications introduced from September 22, 2014; Having regard to the Royal Decree of 2 December 1986 relating to the request, the issue and the maintenance in force of invention patents, article 28; Given the patent application received by the Intellectual Property Office on June 15, 2016. Whereas for patent applications falling within the scope of Title 1, Book XI of the Code of Economic Law (hereinafter CDE), in accordance with article XI. 19, §4, paragraph 2, of the CDE, if the patent application has been the subject of a search report mentioning a lack of unity of invention within the meaning of §ler of article XI.19 cited above and in the event that the applicant does not limit or file a divisional application in accordance with the results of the search report, the granted patent will be limited to the claims for which the search report has been drawn up. Stopped : First article. - It is issued to GLAXOSMITHKLINE BIOLOGICALS SA, Rue de l'Institut 89, 1330 RIXENSART Belgium; represented by PRONOVEM - Office Van Malderen, Avenue Josse Goffin 158, 1082, BRUXELLES; a Belgian invention patent with a duration of 20 years, subject to payment of the annual fees referred to in article XI.48, §1 of the Code of Economic Law, for: IMMUNOGENIC COMPOSITIONS. INVENTOR (S): GERKE Christiane, c / o GSK Vaccines Institute for Global Health S.r.l., Via Fiorentina 1, 53100, SIENA; MARTIN Laura Bartle, c / o GSK Vaccines Institute for Global Health S.r.l., Via Fiorentina 1, 53100, SIENA; SAUL Allan James, c / o GSK Vaccines Institute for Global Health S.r.l., Via Fiorentina 1, 53100, SIENA; PRIORITY (S): 06/16/2015 EP 15020097.0; DIVISION: divided from the basic application: filing date of the basic application: Article 2. - This patent is granted without prior examination of the patentability of the invention, without guarantee of the merit of the invention or of the accuracy of the description thereof and at the risk and peril of the applicant (s) ( s). Brussels, 01/15/2018, By special delegation: BE2016 / 5444 IMMUNOGENIC COMPOSITIONS compositions compositions Technical area This invention relates to immunogens, particularly vaccines, for use in providing protection against disease caused by bacterial infection with Shigella strains. Context of the invention Shigellosis represents a major global health problem responsible for more than 7 million years of disability-adjusted life and 100,000 deaths per year, especially in children under 5 in developing countries [1, 2,3]. Shigellosis is caused by Gram negative bacteria of the genus Shigella, which is divided into 4 species further differentiated into 50 serotypes based on the structure and composition of the external polysaccharide antigen (O antigen, AgO) of the lipopolysaccharide (LPS): S. sonnei (1 serotype), S. flexneri (15 serotypes), S. boydii (19 serotypes) and S. dysenteriae (15 serotypes) [4]. A limited number of BE2016 / 5444 serotypes contribute to the global burden of the disease and these vary between regions and over time [4,5,6,7]. Shigella sonnei and Shigella flexneri 2a are the currently dominant serotypes in the world [4,6]. The hallmark of clinical shigellosis is acute ulcerative colitis associated with fever, nausea, anorexia, dehydration, mucopurulent and bloody diarrhea, and tenesmus. Dysentery caused by Shigella is endemic and causes millions of disease episodes in developing countries. For example, it is estimated that there are 125 million cases of Shigella diarrhea per year, 99% of which occur in developing countries and 69% in children under the age of five. Morbidity and mortality from shigellosis are especially high among children in developing countries. Existing approaches to Shigella vaccines (described in [8]) were based on live attenuated strains for oral immunization, O saccharides conjugated for injection, proteosomes (vesicles of the meningococcal outer membrane with Shigella LPS fixed) for intranasal use, invaplexes (subcellular Shigella extracts including IpaB, iPaC and LPS) for intranasal use, and nuclear protein-ribosome complexes prepared from AmsbB strains with detoxified LPS. Although two of these vaccines have been effective in trials BE2016 / 5444 in the field, none protects against multiple Shigella serotypes. The most successful recent candidate vaccine, a conjugate of S. son's AgO! parental, demonstrated 74% protection against infection by homologous S. sonnei in young adults after immunization [9] and 71% efficacy in children over 3 years of age after two immunizations [10]. On the contrary, the vaccine displayed low immunogenicity and a lack of protection in children under 3 years of age [10]. The protection rate is in parallel with the specific antibody response rate of the AgO-based vaccine, measured in antibody response against the LPS of S. sonnei with the homologous AgO (anti-LPS response) [10] . Thus, an object of the invention is to provide improved immunogenic compositions, particularly vaccine compositions which can be used to protect against multiple serotypes of Shigella. More particularly, an object is to provide vaccine compositions which produce stronger responses against AgO, especially in young children. Brief description of the invention In a first aspect, the invention provides an immunogenic composition comprising generalized modules for membrane antigens (GMMA) purified from Shigella sonnei and Shigella flexneri. In particular, the GMMAs comprise a modified lipid A. In particular, the modified lipid A BE2016 / 5444 is a less toxic or detoxified form of lipid A, by way of nonlimiting example, a pentaacylated lipid A, a hexa-acylated lipid A which does not exist in the natural state in which one of the acyl groups is substituted and / or a hexa-acylated lipid A in which the lauroyl chain is replaced by a palmitoleoyl chain. Even more particularly, at least 75% of the Shigella sonnei GMMAs have a diameter in the range of 25 nm to 40 nm, determined by electron microscopy. Shigella sonnei GMMAs can have an average radius in the range of 32 nm to 38 nm (determined by HPLC-SEC MALLS) and S. flexneri GMMAs can have an average radius (HPLCSEC MALLS) between 21 nm and 28 nm. In one embodiment, the GMMAs of Shigella flexneri are purified from at least one strain chosen from the group consisting of 2a, 3a and 6. In particular, the immunogenic composition comprises GMMAs of Shigella flexneri purified from each of the strains 2a, 3a and 6. In one embodiment, the immunogenic composition comprises GMMAs purified from (a) Shigella sonnei, (b) Shigella flexneri 2a, (c) Shigella flexneri 3a and (d) Shigella flexneri 6. In particular, GMMAs are present in a ratio of l / l / l / l. Even more particularly, the immunogenic composition comprises GMMA proteins at a concentration of less than 100 μg / ml. In particular, the immunogenic composition comprises GMMAs of Shigella flexneri purified from each of strains 2a, 3a and 6 and GMMAs purified from at least one other strain of Shigella flexneri BE2016 / 5444 chosen from the group consisting of strains 1b and 2b. In particular, the immunogenic composition comprises GMMAs purified from (a) Shigella sonnei AtolR, AhtrB, virG :: nadAB, (b) Shigella flexneri 2a AtolR, AmsbB, (c) Shigella flexneri 3a AtolR, AmsbB and (d) Shigella flexneri 6 AtolR, AmsbB or AhtrB. Even more particularly, the Shigella flexneri strain or strains lack the virulence plasmid. The composition may also contain GMMAs from other strains of S. flexneri. In particular, the immunogenic composition comprises an adjuvant. Even more particularly, the adjuvant is an adsorbent. Even more particularly, the adjuvant is an adsorbent which does not enhance the immunogenicity of GMMAs, for example, as it is measured by the antiLPS antibody response. Particular builders include, for example, aluminum builders including aluminum hydroxide, ALHYDROGEL®, aluminum phosphate, potassium aluminum sulfate and alum. In a second aspect, the invention provides a method of immunizing a patient against Shigella infection comprising the step of administering to the patient an immunogenic composition of the first aspect of the invention. In a third aspect, the invention provides a composition of the first aspect of the invention for use in a method of immunizing a patient against Shigella infection. BE2016 / 5444 Brief description of the figures Figure 1: Increase in mean temperature (mean temperature after vaccination - before vaccination) in rabbits after IM injection of a dose containing 100 µg of 17 90GAHB protein (circles) or an equivalent volume of saline (diamonds). The vertical bars show the standard deviation of the mean. N = 12 for 90GAHB and 6 for rabbits to which physiological saline is injected. Figure 2 (A): Anti-LPS antibody level of S. sonnei (median post-vaccination rates) produced after immunization dose 1, 2 and 3 in a clinical trial with human subjects. Figure 2 (B): Anti-LPS antibody level of S. sonnei (median rates after vaccination) over the entire study including a 6-month follow-up after immunization 3 in a clinical trial with human subjects. Figure 3 - Box diagrams showing the distribution of antibodies in groups immunized with 1790GAHB, S. flexneri-2a, S. flexneri-3a and a tetravalent combination estimated by an ELISA test using purified LPS from (A) S. sonnei, (B) S. flexneri 3a, and (C) S. flexneri 2a as a sensitizing antigen. On (A) and (B), the ELISA units are plotted, on (C), the ELISA DOs are presented. The 25th to 75th percentile is represented in the form of a rectangle, the minimum and maximum values in the form of whiskers and the median in the form of the horizontal bar in the rectangle. BE2016 / 5444 The detection limits in the tests were 2.2 (A) and 1.6 (B) ELISA units. The results below the detection limit were assigned the value of half the detection limit (1.1 on A, 0.8 on B). The mean OD of the background noise in the tests represented on (C) was 0.056. Figure 4: Dispersion diagrams showing the individual results transformed into log of anti-AgO antibodies to S. sonnei (A), anti-S. flexneri 3a (B) or DO ELISA results from the distribution of anti-S antibodies. flexneri 2a (C) in each group against the dosages transformed into log. The parallel dose-response curves of the simple formulations and the tetravalent formulation are presented. (A) Curves dose-response for the 1790GAHB and the combination tetravalent on the LPS by S. sonnei. (B) Dose-response curves for S. flexneri 3a and the combination tetravalent on the LPS by S. flexneri 3a. (C) Curves dose-response for S. flexneri 2a and the combination tetravalent on the LPS by S. flexneri 2a. The points of intersection with the Y axis of the curves are not significantly different, P = 0.31 (A), P = 0.74 (B), P = 0.75 (C). Detailed description of the invention The generalized modules for membrane antigens or GMMA are particles derived from the outer membrane of Gram negative bacteria which have high levels of LPS, lipoproteins, proteins and other antigens which activate the innate immune response. GMMAs are produced from BE2016 / 5444 antigens example, genetically modified bacterial strains which are mutated to amplify the production of vesicles and to eliminate or modify antigens (for example, lipid A). Amplified spontaneous vesicle production can be achieved, for example, by a targeted deletion of proteins involved in maintaining the integrity of the membrane (see below). The external surface of GMMAs corresponds to the external surface of the bacteria from which they are derived, preserving all membranes (including, by lipopolysaccharides, lipooligosaccharides, lipoproteins, proteins) in the context of the membrane. GMMAs (unlike OMVs extracted by a detergent) retain these components of the outer membrane in their native conformation and correct orientation, better preserving immunogenicity against the bacterial strain from which they are derived. Thus, GMMAs are highly immunogenic and this strong activation of innate immunity can lead to unacceptable reactions in human subjects, for example, a febrile response or, in extreme cases, septic shock especially if administered by parenteral route. The invention is based on the discovery that genetic manipulation can be used to provide bacterial strains of Shigella that produce GMMAs that are immunogenic, even at low doses, with a reduced risk, for example, of pyrogenicity. The inventors have also discovered that the use of an aluminum adjuvant is advantageous BE2016 / 5444 in increasing the in vivo tolerance of immunogenic compositions comprising GMMAs, further reducing the risk, for example, of pyrogenicity. As a result, doses of GMMA purified from multiple bacterial strains of Shigella can be combined to prepare a multivalent immunogenic composition having a concentration of total GMMA proteins per dose of up to 100 µg / ml or higher. This finding is surprising because, in the literature, studies have generally sought to reduce the content of OMV to avoid fever which could compromise the acceptability of vaccines containing OMV derived by a detergent in the vaccination schedules of infants. For example, in studies of the 4CMenB vaccine, Bexsero, it has been observed that approximately half of subjects experience a temperature> 38.5 ° C after vaccination with the first dose [11]. On the contrary, the data from clinical trials provided in the examples here demonstrate that vaccination with an immunogenic composition comprising 100 μg / ml of GMMA S. sonnei (four times the equivalent content of OMV in 4CMenB) was well tolerated. Data in humans are supported by immunogenicity results produced in mice and rabbits. Shigella bacteria The invention is based on the use of Shigella bacteria chosen from one or more of the serogroups S. dysenteriae, S. flexneri, S. boydii and S. sonnei. In particular, the invention is based on the use of at least two strains of Shigella BE2016 / 5444 S. S. chosen from the S. flexneri and S. sonnei serogroups, chosen particularly from the group consisting of S. sonnei, S. flexneri 2a, S. flexneri 3a and flexneri 6. In some embodiments, sonnei 53G, S. flexneri lb STANSFIELD, S. flexneri 2a 2457T, S. flexneri 2b 69/50, S. flexneri 3a 6885 and / or S. flexneri 6 10.8537 can be used. Particularly, the Shigella strains for use in the invention are AtolR strains having a disturbed Tol-Pal system which pushes the bacterium to release greater amounts of GMMA in the culture medium during bacterial replication. The deletion of other genes in the Tol-Pal complex (for example, TolA) could also be envisaged, for example, as it is disclosed in document WO 2011/036564. Shigella strains for use in the invention include one or more other changes from a wild type strain. In particular, the strains for use with the invention include one or more mutations producing inactivation of htrB, msbBl and / or msbB2. By way of nonlimiting example, appropriate mutations can be chosen from the group consisting of AhtrB, AmsbBl and AmsbB2. For simplicity, the double deletions of both msbBl and msbB2 can also be called ADmsbB. Inactivation of htrB or msbB1 and msbB2 reduces acylation in lipid A. In some embodiments, the strains for use with the invention lack the O antigen in LPS, BE2016 / 5444 thereby avoiding specific serotype responses. In S. sonnei, the O antigen is absent when the virulence plasmid is eliminated. In other embodiments, the strains for use with the invention produce LPS comprising the O antigen. The presence of the O antigen may be beneficial since the immunogenic compositions will trigger both specific immune cross responses of the serotype and additional. The absence of hexa-acylated lipid A in the LPS is preferred. Loss of the virulence plasmid leads to the loss of the msbB2 gene, and the chromosomal gene msbB1 can be inactivated, thereby eliminating myristoyl transferase activity and providing penta-acylated lipid A in LPS. For the msbB mutants of S. flexneri, the absence of the virulence plasmid which contains the msb2 gene is preferred. Preferred strains of Shigella for use in the invention include a penta-acylated LPS. Alternatively, inactivation of htrB results in the loss of the lauroyl chain and thus produces penta-acylated LPS in certain strains and / or forms of lipid A which are less toxic than wild type lipid A. For example, in S. flexneri, the inactivation of htrB can be compensated by the activity of another enzyme, LpxP which produces a hexa-acylated lipid A, in which the lauroyl chain is replaced by a palmitoleoyie chain. Hexa-acylated lipid A comprising palmitoleoyie chains is less toxic than wild-type lipid A. Thus, in certain embodiments, the invention provides a composition BE2016 / 5444 immunogen comprising GMMAs purified from Shigella sonnei and Shigella flexneri in which the GMMAs comprise a penta-acylated lipid A and / or a hexa-acylated lipid A in which the lauroyl chain is replaced by a palmitoleoyl chain. In particular, the strains suitable for use in the invention include the following mutations (a) Shigella sonnei: AtolR, AhtrB, virG :: nadAB, (b) Shigella flexneri 2a: AtolR, AmsbB, (c) Shigella flexneri 3a: AtolR , AmsbB and (d) Shigella flexneri 6: AtolR, AmsbB or AhtrB. Appropriate strains are disclosed in the examples. Other suitable strains are known in the art, for example in document WO 2011/036564. The culture conditions for developing Shigella are well known in the art, for example, see references [12] to [14]. For example, they can be developed using a source of organic nitrogen (such as mixtures of amino acids, for example, containing Ala, Arg, Asn, Asp; casamino acids can be used), glycerol as carbon source, etc. The inclusion of L-aspartic acid in the medium is particularly useful and can function as a source of both nitrogen and carbon. For S. sonnei, the genes for the O antigens are on the virulence plasmid and an AgO component is desirable for GMMAs purified or isolated therefrom. Thus, in certain embodiments, the strain S. sonnei is mutated to replace virG with nadA and nadB originating from E. coli, thereby eliminating auxotrophy for nicotinic acid from BE2016 / 5444 Shigella while retaining the virulence plasmid; the production of the AgO encoded by the plasmid is ensured by growth in a medium without nicotinic acid. An example of a mutant strain of S. sonnei may include the following modifications: AtolR :: kan AvirG:: nadAB AhtrB :: cat. Examples of mutant strains of S. flexneri may include the following modifications: AtolR :: kan AhtrB :: cat or AtolR :: kan AmsbBl :: cat. Only the msbB1 mutation is introduced into the strain lacking the plasmid because the elimination of the plasmid eliminates the second copy of msbB (msbB2). Generalized modules for membrane antigens (GMMA) The Shigella bacteria used in the invention are, relative to their corresponding wild-type strains, hyper-budding, that is to say that they release in their culture medium greater quantities of GMMA than the wild-type strain . These GMMAs are useful as components of the Shigella vaccines of the invention. The term GMMA is used to provide a clear distinction between vesicles of the outer membrane extracted by a traditional detergent (dOMV), and vesicles of the outer outer membrane (NOMV), which are released spontaneously from Gram negative bacteria. GMMAs differ in two crucial aspects from NOMVs. First, to induce the formation of GMMA, the structure of the membrane was modified by deletion of the genes coding for the key structural components, specifically tolR. Second, like BE2016 / 5444 as a result of genetic modification, large quantities of the outer membrane bud (the Italian name for bud is "gemma") to provide a practical source of membrane materials for vaccine production, leading to greater ease of manufacture and a potential cost reduction. While NOMVs have been used for immunogenicity studies, the yields are too low for practical vaccines. The GMMAs of S. sonnei used in the invention generally have a diameter of 25 nm to 140 nm by electron microscopy, for example from 25 nm to 40 nm. GMMAs can also have a bimodal size distribution. For example, the majority of GMMAs having an average size of 25 nm to 40 nm in diameter (by ME) and a fraction of the particles having an average size of 65 nm to 140 nm. In particular, at least 70%, at least 71%, at least 72%, at least 73%, at less 74%, at least 75%, at least 80 %, at least 85 %, at less 90% of GMMA will have a diameter of 25 nm to 140 nm. The GMMA are released spontaneously during the bacterial growth and can be purified from the culture medium. Purification ideally involves the separation of GMMAs from live and / or intact Shigella bacteria, for example, by size-based filtration using a filter, such as a 0.2 µm filter, which allows GMMAs to pass through but which does not allow intact bacteria to pass through, or using low speed centrifugation to obtain a pellet BE2016 / 5444 cell while leaving the GMMAs in suspension. Appropriate purification methods are known in the art. A preferred two-stage filtration purification process is described in WO 2011/036562 incorporated herein by reference. In particular, the two-stage filtration process is used to separate the GMMAs from the cell culture biomass without using centrifugation. The GMMA-containing compositions of the invention will generally be substantially free from whole bacteria, whether living or dead. The size of GMMAs means that they can be easily separated from whole bacteria by filtration, for example, as it is generally used for sterilization by filtration. Although GMMAs pass through standard 0.22 µm filters, these can be quickly clogged with other materials, and thus it may be useful to carry out sequential stages of sterilization by filtration through a series of filters with decreasing pore size before using a 0.22 µm filter. The previous filter examples will be those with a pore size of 0.8 µm, 0.45 µm, etc. GMMAs are released spontaneously from bacteria and separation from the culture medium, for example, using filtration, is practical. Vesicles of the outer membrane formed by methods that involve a deliberate disturbance of the outer membrane (for example, by treatment with a detergent, such as extraction with BE2016 / 5444 deoxycholate, or a sonication) for causing the formation of vesicles of the outer membrane are excluded from the scope of the invention. The GMMAs used in the invention are substantially free from contamination of the internal and cytoplasmic membrane and they contain lipids and proteins. Immunogenic compositions The immunogenic compositions of the invention can comprise GMMAs purified from at least two, three, four, five or six different strains of Shigella. In particular, the immunogenic compositions comprise GMMAs purified from Shigella sonnei and Shigella flexneri. The Shigella flexneri GMMAs can be purified from at least one strain chosen from the group consisting of 2a, 3a and 6. In particular, the immunogenic composition comprises Shigella flexneri GMMAs purified from each of the strains 2a, 3a and 6. The immunogenic composition can also comprise GMMAs of Shigella flexneri purified from at least one strain chosen from the group consisting of lb and 2b. In one embodiment, the immunogenic composition comprises GMMAs purified from (a) Shigella sonnei, (b) Shigella flexneri 2a, (c) Shigella flexneri 3a and (d) Shigella flexneri 6. In certain embodiments, the immunogenic composition includes GMMAs purified from Shigella sonnei 53G, Shigella flexneri 2a 2457T, Shigella flexneri 3a 6885 and Shigella flexneri 6 10.8537 and possibly Shigella flexneri lb STANSFIELD and / or Shigella flexneri 2b 69/50. BE2016 / 5444 Where at least two different types of GMMA are used, they may be present in a ratio of 1/1, 1/2, 1/3, 1/4, 2/1, 3/1 or 4/1, preferably about 1/1. In particular, at least two of the four different GMMAs in the immunogenic composition are present in a ratio of 1/4 to 4/1. Where GMMAs from at least four different serotypes are used, they may be present in a ratio chosen from the options provided in the table below, for example, a ratio of l / l / l / l (option of ratio 1 ). When reference is made to such ratios, it is evident that it will generally be difficult to formulate an immunogenic composition having the exact ratio and that some variability will exist. S. sonnei (Ss), S. flexneri 2a (2a), S. flexneri 3a (3a) and S. flexneri 6 (6) Option to Ss / 2a / Option to Ss / 2a / Option to Ss / 2a / report 3a / 6 report 3a / 6 report 3a / 6 1 l / l / l / l 23 1/4/2/2 45 2/4/2/1 2 1/1/1/2 24 1/4/2/4 46 2/4/4/1 3 1/1/1/4 25 1/4/4/1 47 4/1/1/1 4 1/1/2/1 26 1/4/4/2 48 4/1/1/2 5 1/1/2/2 27 1/4/4/4 49 4/1/1/4 6 1/1/2/4 28 2/1/1/1 50 4/1/2/1 7 1/1/4/1 29 2/1/1/2 51 4/1/2/2 8 1/1/4/2 30 2/1/1/4 52 4/1/2/4 9 1/1/4/4 31 2/1/2/1 53 4/1/4/1 10 1/2/1/1 32 2/1/2/2 54 4/1/4/2 11 1/2/1/2 33 2/1/2/4 55 4/1/4/4 12 1/2/1/4 34 2/1/4/1 56 4/2/1/1 13 1/2/2/1 35 2/1/4/2 57 4/2/1/2 14 1/2/2/2 36 2/1/4/4 58 4/2/1/4 BE2016 / 5444 15 1/2/2/4 37 2/2/1/1 59 4/2/2/1 16 1/2/4/1 38 2/2/1/2 60 4/2/4/1 17 1/2/4/2 39 2/2/1/4 61 4/4/1/1 18 1/2/4/4 40 2/2/2/1 62 4/4/1/2 19 1/4/1/1 41 2/2/4/1 63 4/4/1/4 20 1/4/1/2 42 2/4/1/1 64 4/4/2/1 21 1/4/1/4 43 2/4/1/2 65 4/4/4/1 22 1/4/2/1 44 2/4/1/4 The immunogenic compositions can include any appropriate amount of GMMA per unit dose. The term "unit dose" refers to an amount of pharmaceutical active ingredient, for example an amount of GMMA protein, suitable for administration in a single dose, according to good medical practice. The amounts of GMMA proteins can be from 0.1 to 200 pg per unit dose, particularly 10 pg, 20 pg, 25 pg, 50 pg or 100 pg. Per unit dose, the aqueous immunogenic compositions of the invention may comprise a total concentration of GMMA proteins of less than 200 pg / ml, less than 100 pg / ml or lower, 80 pg / ml or lower, 50 pg / ml or lower, 25 pg / ml or lower, 20 pg / ml or lower, 15 pg / ml or less, 10 pg / ml or lower. By unit dose, the aqueous immunogenic compositions of the invention may comprise a total concentration of GMMA proteins from 5 pg / ml to 200 pg / ml, from 5 pg / ml to 100 pg / ml, from 10 pg / ml to 100 pg / ml, from 10 pg / ml to 80 pg / ml, from 10 pg / ml to 50 pg / ml, 25 pg / ml to 50 pg / ml. Per unit dose, the immunogenic compositions of the invention may comprise a total concentration of GMMA proteins greater than 100 pg / ml, greater BE2016 / 5444 at 80 pg / ml, more than 50 pg / ml, more than 25 pg / ml, more than 20 pg / ml, more than 15 pg / ml or more than 10 pg / ml. The amount of GMMA can also be quantified by measuring the AgO polysaccharide. For example, the ratio of the AgO polysaccharide to proteins (AgO / proteins, expressed in terms of w / w) can be in the range of 0.06 to 1.1 pg AgO / pg protein, 0.65 to 1.1 pg AgO / pg protein, 0.75 to 1.1 pg AgO / pg protein or 0.85 to 1.0 pg AgO / pg protein. In particular, for S. flexneri 2a, the AgO / protein ratio can be 0.85 to 1.0 pg of AgO / pg of proteins, for S. flexneri 3a, the AgO / protein ratio can be from 0.75 to 1.1 pg of AgO / pg of proteins, for S. sonnei and S. flexneri 6, the AgO / protein ratio can be 0.06 to 1.0 pg AgO / pg protein, particularly about 0.06 pg AgO / pg protein. Thus, based on an AgO / protein ratio of 0.75 pg of AgO / pg of proteins, particular amounts of GMMA per unit dose can be as above in the range of 150 to 200 pg / ml and based on an AgO / protein ratio of 0.8 to 1.0 pg AgO / pg protein, particular amounts of GMMA per unit dose can be as above particularly in the range of 160-200 pg / ml. GMMA proteins from each different serotype can be present in an amount of 0.1 to 200 pg, for example 0.1 to 80 pg, 0.1 to 100 pg and in particular 5 to 25 pg. Appropriate amounts of GMMA from each different serotype may include 0.1, 1, 5, 10, 20, 25, 30, BE2016 / 5444 35, 40, 45, 50, 60, 70, 80, 90 and 100 pg per unit dose. The immunogenic compositions of the invention include GMMAs purified or isolated from more than one strain of Shigella and it is typical that GMMAs are prepared before mixing with pharmaceutically acceptable excipients, such as buffers. The GMMAs from each strain can be formulated individually with an adjuvant, such as ALHYDROGEL®, before combining with GMMAs purified or isolated from another strain and mixing with one or more pharmaceutically acceptable excipients. Alternatively, the GMMAs from each strain can be purified / isolated, combined with purified GMMAs or isolated from the other or other strains, formulated with an adjuvant and then mixed with one or more pharmaceutically acceptable excipients. Other methods will be obvious to those skilled in the art. The terms "purified" and "isolated" are generally taken to have the meaning of art. Preferably, the purified or isolated GMMAs are cell-free preparations, even more preferably the GMMAs have low levels of contamination by cytoplasmic proteins, for example, less than 10%, less than 9%, less than 8% , less than 7%, less than 6%, less than 5% or less than 4%. For example, measured using high sensitivity mass spectrometry with an intensity-based absolute quantification index (iBAQ) without a marker compared to solubilized cell compositions of the strains producing BE2016 / 5444 GMMA, practically the entire protein content in GMMA is derived from proteins located in the outer membrane or periplasmic, particularly more than 90%, even more particularly more than 95%, more than 96%, more than 97%, more 98% or more than 99%. Thus, more than 95% of the protein content in GMMAs includes proteins located in the outer membrane or periplasmic. Specifically, the purified / isolated GMMAs include approximately 10-fold enrichment of both periplasmic and outer membrane proteins in the GMMAs compared to the total cellular proteins of the GMMA producing strains. In short, the immunogenic compositions of the invention can be administered in single or multiple doses. A single dose of the immunogenic compositions of the invention may be effective. Alternatively, a unit dose followed by a second unit dose may be effective. Generally, the second (or third, fourth, fifth, etc.) unit dose is identical to the first unit dose. The second unit dose can be administered at any appropriate time after the first unit dose, especially after 1, 2 or 3 months. Generally, the immunogenic compositions of the invention will be administered intramuscularly, for example, by intramuscular administration in the thigh or upper arm as described below, but they may also be administered intradermally or intranasally. BE2016 / 5444 The immunogenic compositions of the invention may include one or more adjuvants. Particular builders include aluminum builders, for example, aluminum hydroxide, ALHYDROGEL®, aluminum phosphate, potassium aluminum sulfate, and alum. The use of aluminum adjuvants is advantageous since the adsorption of GMMAs on the adjuvant reduces the pyrogenic response making it possible to administer 100 times greater doses of GMMA in rabbits compared to GMMAs alone. The use of other adjuvants which also reduce the pyrogenic response is also contemplated and can be identified by those skilled in the art using the tests exemplified below. While the term "adjuvant" generally refers to any substance that enhances the immune response to an antigen, in this case, and without wishing to be bound by assumptions, the adjuvant, such as ALHYDROGEL®, is also a reducing adsorbent the immune response to GMMA. Thus, the term "adsorbent" refers to a solid substrate or a material to which GMMAs can bind, attach, or adsorb (for example, through Van der Waals interactions or hydrogen bonds) in such a way that the pyrogenic response to GMMAs is reduced compared to GMMAs which are not thus bound, fixed or adsorbed. By way of nonlimiting example, the immunogenicity of GMMAs can be measured by comparing the anti-LPS antibody response. BE2016 / 5444 Pharmaceutical processes and uses The immunogenic compositions of the invention may further comprise a pharmaceutically acceptable carrier. Typical "pharmaceutically acceptable carriers" include any carrier which does not itself induce the production of antibodies harmful to the individual receiving the composition. Suitable carriers are generally large, slowly metabolized macromolecules such as proteins, polysaccharides, poly lactic acids, poly glycolic acids, polymeric amino acids, amino acid copolymers, sucrose, trehalose, lactose, and aggregates lipids (such as oil droplets or liposomes). Such supports are well known to a person with average skills in the field. The immunogenic compositions of the invention can also contain diluents, such as water, physiological saline, glycerol, etc. Additionally, auxiliary substances, such as wetting agents or emulsifiers, pH buffering substances, and the like, may be present. Physiological saline buffered with sterile pyrogen-free Tris is a particularly preferred carrier when using aluminum adjuvants because the phosphate in the phosphate buffer solution can interfere with the binding of GMMA to aluminum. The compositions can be prepared in the form of injectables, in the form of either solutions or liquid suspensions. Solid forms suitable for solution in, or suspension BE2016 / 5444 in, liquid vehicles before injection can also be prepared (for example, a lyophilized composition or a composition freeze-dried by spraying). The composition can be prepared for topical administration, for example, in the form of an ointment, a cream or a powder. The composition can be prepared for oral administration, for example, in the form of a tablet or capsule, in the form of a spray, or in the form of a syrup (optionally flavored). The composition can be prepared for pulmonary administration, for example, in the form of an inhaler, using a fine powder or a spray. The composition can be prepared in the form of a suppository or an ovum. The composition can be prepared for nasal, ear or eye administration, for example, in the form of drops. The composition can be in the form of a kit, designed such that a combined composition is reconstituted just before administration to a mammal. Such kits can include one or more antigens in liquid form and one or more freeze-dried antigens. The compositions can be presented in vials, or they can be presented in pre-filled syringes. Syringes can be supplied with or without a needle. A syringe will comprise a single dose of the composition, while a vial may comprise a single dose or multiple doses. The aqueous compositions of the invention are also suitable for reconstituting other vaccines from a lyophilized form. When a BE2016 / 5444 composition of the invention must be used for such an extemporaneous reconstitution, the invention provides a kit, which can include two vials, or which can include a pre-filled syringe and a vial, with the contents of the syringe used to reactivate the contents of the vial before injection. The compositions of the invention can be packaged in a unit dose form or in a multiple dose form. For multiple dose forms, vials are preferred over pre-filled syringes. Effective dosage volumes can be established routinely, but a typical human dose of the composition has a volume of 0.5 ml, for example, for intramuscular injection. The pH of the composition is preferably between 6 and 8, preferably about 7. For compositions comprising acetylated O antigens, particularly the pH of the composition is less than 7, preferably about 6 (to slow the rate of deesterification ). A stable pH can be maintained by the use of a buffer. The immunogenic compositions of the invention can comprise a Tris buffer [Tris (hydroxymethyl) aminomethane]. The Tris buffer can comprise about 1 to 20 mM of [Tris (hydroxymethyl) aminomethane], for example, 1.25 mM, 2.5 mM, 5.0 mM or 10.0 mM. For compositions comprising acetylated O antigens, particularly the buffer is not a Tris buffer. The immunogenic compositions of the invention may include a 5 to 20 mM succinate buffer, for example, 5 mM, 7.5 mM, 10 mM, 12.5 mM, 15 mM, 17.5 mM or 20 mM. Immunogenic compositions BE2016 / 5444 of the invention can comprise a histidine buffer at 5 to 20 mM, for example, 5 mM, 7.5 mM, 10 mM, 12.5 mM, 15 mM, 17.5 mM or 20 mM. The composition will be sterile. The compositions of the invention can be isotonic with respect to humans. Thus, the compositions of the invention can be useful as vaccines. The vaccines according to the invention can be either prophylactic (that is to say to prevent an infection) or therapeutic (that is to say to treat an infection), but they will generally be prophylactic. The term "protected against infection" means that a subject's immune system has been sensitized (for example, by vaccination) to trigger an immune response and repel infection. It will be clear to a person skilled in the art that a vaccinated subject can thus become infected, but is better able to repel the infection than a control subject. The term "treatment" includes both therapeutic treatment and prophylactic or preventive treatment, where the object is to prevent or lessen an infection. For example, treatment may include direct influence or cure, suppression, inhibition, prevention, reduction in severity, delay in onset, reduction in symptoms associated with, for example, infection or 'one of their combinations. "Prevention" may relate to, inter alia, delay in the onset of symptoms, prevention of relapse of a disease, and the like. Treatment may also include BE2016 / 5444 "suppression" or "inhibition" of an infection or disease, for example, a reduction in the severity, number, incidence or latency of symptoms, improvement in symptoms, reduction of secondary symptoms, reduction of secondary infections, prolongation of patient survival, or combinations thereof. The immunogenic compositions used as vaccines include an immunologically effective amount of one or more antigens, as well as all of the other components, as required. By "immunologically effective amount" it is meant that the administration of this amount to an individual, either in a single dose or as part of a series, is effective for treatment or prevention. This amount varies according to the health and physical condition of the individual to be treated, his age, the taxonomic group of the individual to be treated (for example, non-human primate, primate, etc.), the ability of the the individual's immune system to synthesize antibodies, the degree of protection desired, the formulation of the vaccine, the physician's assessment of the medical situation, and other relevant factors. The amount is expected to be within a relatively wide range which can be determined by routine testing. The compositions of the invention may include an antimicrobial, particularly when packaged in multiple dose formats. The compositions of the invention may include sodium salts (e.g. sodium chloride) for BE2016 / 5444 give tone. A concentration of 10 ± 2 mg / ml NaCl is typical. In some embodiments, a concentration of 4 to 10 mg / ml NaCl can be used, for example, 9.0, 7.0, 6.75 or 4.5 mg / ml. The compositions of the invention will generally include a tampon. Processing procedures The invention also provides a method of raising an immune response in a mammal, comprising administering a pharmaceutical composition of the invention to the mammal. The immune response is preferably protective and it preferably involves antibodies. The method may raise a callback response. The mammal is preferably a human being. When the vaccine is intended for prophylactic use, the human being can be an adult, a child (for example, a young child or an infant) or an adolescent; when the vaccine is intended for therapeutic use, the human being is preferably a child. A vaccine for children can also be given to adults, for example, to estimate safety, dosage, immunogenicity, etc. A preferred class of humans for treatment is women of childbearing age (for example, adolescent girls and older people). Another favorite class is pregnant women. The invention also provides a composition of the invention for use as a medicament. The drug is preferably capable of raising a BE2016 / 5444 immune response in a mammal (i.e. it is an immunogenic composition) and it is more preferably a vaccine. The invention also provides the use of a composition of the invention in the manufacture of a medicament for enhancing an immune response in a mammal. These uses and methods are preferably for the prevention and / or treatment of diseases caused by Shigella, for example, shigellosis, dysentery and associated symptoms including diarrhea, fever, abdominal pain, tenesmus, etc. These uses and methods are preferably for the prevention and / or treatment of diseases caused by both Shigella sonnei and Shigella flexneri. The compositions of the invention will generally be administered directly to a patient. Direct administration can be accomplished by parenteral injection (e.g., subcutaneous, intraperitoneal, intravenous, intramuscular, or interstitial tissue), or by rectal, oral, vaginal, topical, transdermal administration intranasal, ocular, auricular, pulmonary or other mucosal. Intramuscular administration in the thigh or upper arm is preferred. The injection can be done using a needle (for example, a hypodermic needle), but an injection without a needle can alternatively be used. A typical intramuscular dose is 0.5 ml. For a BE2016 / 5444 administration to a human, the dose may be approximately 100 μg measured by proteins, for example, administered in a dose of 0.5 ml at a concentration of 200 μg of proteins / ml. The invention can be used to trigger systemic and / or mucosal immunity. Dosage therapy can be a single dose schedule or a multiple dose schedule. Multiple doses can be used in a primary immunization schedule and / or in a booster immunization schedule. A primary dose schedule may be followed by a booster dose schedule. The appropriate time between sensitization doses (for example, between 4 and 16 weeks), and between sensitization and booster doses, can be determined routinely. General The term "comprising" includes "including" as well as "consisting of", for example, a composition "comprising" X may consist exclusively of X or it may include something additional, for example, X + Y. The term "substantially" does not exclude "completely", for example, a composition which is "substantially free" of Y may be completely free of Y. Where necessary, the term "substantially" may be omitted from the definition of the invention. Unless otherwise indicated, a process comprising a step of mixing two or more components does not require a specific order of mixing. So, BE2016 / 5444 the components can be mixed in any order. When there are three components, then two components can be combined with each other, and then the combination can be combined with the third component, etc. Unless otherwise indicated, the identity between polypeptide sequences is preferably determined by the SmithWaterman homology search algorithm as implemented in the MPSRCH (Oxford Molecular) program, using an affine gap search with parameters of breach opening penalty = 12 and breach extension penalty = 1. The practice of the present invention will employ, unless otherwise indicated, traditional methods of chemistry, biochemistry, molecular biology, immunology and pharmacology, within the skill of the art. Such techniques are fully explained in the literature. In certain implementations, the term “comprising” refers to the inclusion of the active agent indicated, such as the polypeptides mentioned or the GMMAs, as well as to the inclusion of other active agents, and of supports, excipients, emollients, stabilizers, etc. pharmaceutically acceptable, as is known in the pharmaceutical industry. In certain implementations, the term “consisting essentially of” relates to a composition, the only active principle of which is the active principle or principles indicated, however, other compounds may be included, which are intended for stabilization, conservation, etc. of BE2016 / 5444 the formulation, but are not directly involved in the therapeutic effect of the active ingredient indicated. The use of the transition phrase "essentially constituted" means that the scope of a claim should be interpreted to include the materials specified or the steps cited in the claim, and those that do not materially affect the characteristic (s) basic and news of the claimed invention. See, in Herz, 537 F.2d 549, 551-52, 190 USPQ 461, 463 (CCPA 1976) (emphasis in original); see also MPEP § 2111.03. Thus, the term "consisting essentially of", when used in a claim of this invention is not intended to be interpreted as an equivalent of "comprising". The term "consisting of" and its variations include and include and are limited to, unless expressly stated otherwise. The term "approximately" in relation to a numerical value x means, for example, x + 10%, x + 5%, x + 4%, x + 3%, x + 2%, x + 1%. Modes of Carrying Out the Invention Production of the S. sonnei strain S. sonnei 53G [15] was chosen as the parent strain. The strain NVGH1859 of S. sonnei {S. sonnei 53G AtolR :: kan AvirG :: nadAB) was obtained by replacing the virG gene encoded by the plasmid [16] in S. sonnei 53G AtolR :: kan [17] with the nadA and nadB genes of E. coli [18]. The upstream and downstream regions of virG were amplified using the primer pairs virGup-5 / virGup-3 (upstream) and virGdown33 BE2016 / 5444 5 / virGdown-3 (downstream) (table 1). The "nadAB" cassette was produced by amplifying nadA and nadB from E. coli using the primers nadA-5 / nadA-3 and nadB-5 / nadB-3 (Table 1). The fragments were inserted into pBluescript (Stratagene) in such a way that nadA and nadB are linked and interposed in the flanking regions of virG. The replacement construct (virGup-nadAB-virGdown) was amplified using the primers virGup-5 / virGdown-3 and used to transform S. sonnei AtolR :: kan prone to transformation as described above [17]. The NVGH1790 strain of S. sonnei {S. sonnei 53G AtolR :: kan AvirG :: nadAB AhtrB :: cat) was produced from NVGH1859 by replacing the htrB gene [19] with the chloramphenicol cat resistance gene as described by Rossi et al. [20]. Table 1 Primers used in this study for the production of GMMA producing strains of S. sonnei Primer SEQIDNo: 5 '-> 3' sequence virGup-5 1 ACTCGAGCTCTGTAGTTGATTTGACAGTTGACATCC virGup-3 2 CTAACCCGGGCACTATATTATCAGTAAGTGGTTGATAAACC virGdown 3 CTAACCCGGGCGTGTTGATGTCCTGC virGdown 4 ACGCGTCGACAGTTCAGTTCAGGCTGTACGC nadA-5 * 5 CTAACCCGGGCAAGCAACTCTATGTCGGTGGAAT nadA-3 * 6 TAT CAAGCT T GGCAAGGCCAATACACAGC nadB-5 * 7 TATCAAGCTTAGGGTTAGAGTGTCTCGTTTTTGTA nadB-3 * 8 CTAACCCGGGCCAGACCAGAACTATTCC * primers nadA and nadB as described by Prunier et al. [18] with small modifications. BE2016 / 5444 Production of the S. flexneri 2a strain Mutants of S. flexneri were prepared as previously described in J Biol Chem. 2014 Sep 5; 289 (36): 24922-24935. S. flexneri 2a 2457T was chosen as the parent strain. For the production of mutants from S. flexneri 2a without a virulence plasmid, a white colony was chosen by its white appearance on Congo red agar before the start of the genetic modification. The elimination of the virulence plasmid (pINV) was confirmed by the absence of the origin of replication (ori) and of the genes encoded by the plasmid, virG and ospD3, using PCR. The primers are listed in Table 2. To produce the deletion of tolR in S. flexneri 2a and S. flexneri 2a-pINV devoid of plasmid, the same strategy and the same primers as described above for the production of the AtolR mutant of S. sonnei (2) were used. The null mutation of msbBl, or htrB, was obtained by replacing the gene of interest with an antibiotic resistance cassette, using the following strategy. The upstream and downstream regions were amplified using the gene-U and gene-D primer pairs. The resistance cassette used to replace the gene was amplified using the pairs of primers EcoRV.Ery.F / EcoRV.Ery.R or EcoRV.Cm.F / EcoRV.Cm.R. The fragments were inserted into pBluescript (Stratagene) in such a way that the antibiotic resistance gene is interposed in the flanking regions of the gene. Replacement construction (upstream region-resistance cassette35 BE2016 / 5444 downstream region) was amplified using the primers binding to the 5 'end of the upstream flanking region and to the 3' end of the flanking region downstream of the gene (see Table 2) and used to transform S. flexneri. In S. flexneri 2a, msbBl and htrB have been replaced by cat. Only the msbB1 mutation had to be introduced into the plasmid-free strain because the plasmid carries the second copy of msbB (msbB2) and this is absent in a plasmid-free strain. To simplify, called AmsbB. Strain 2a (mutant S. flexneri 2457T is S. flexneri on NVGH2404 from AtolR :: kan, AmsbB :: cat) has been produced. Table 2 Primers used in this study for the production of GMMA producing strains of S. flexneri 2a Primer name SEQIDNO: Sequence 5 '-> 3' htrB-Ul Xba Sma 9 CTAGTCTAGAAACCCGGGCAATTGTATGTATTGTCG htrB-soOZ Sacl 10 ACTCGAGCTCCCGTCATCATCCAACGC htrB-flexO2 Sacl 11 ACTCGAGCTCATCCGATATACGTTCGCCC htrB-soDl Sali 12 ACGCGTCGACCTCAGTAATCAGGGTTCTTTG htrB-soO2 Smal 13 CTAACCCGGGTAAATCTCCCCTGCCGGATG htrB-flexOl Sali 14 ACGCGTCGACCCTGTAATCTCAGGTCAAATG htrB-flexO2 Smal 15 CTAACCCGGGTAAATCTCCCATGCCGGATG msbB-flexU5 Sma 16 CTAGTCTAGAAACCCGGGTGATAGTGTAGCGGCACA msbB-flexU3 Bag 17 ACTCGAGCTCGTGAGCAAAGCCAGCTG msbB-flexDS Sali 18 ACGCGTCGACCTCGGTGTGGAAATTGG msbB-flexD3 Xba Sma 19 CTAACCCGGGCAACGTACTTACTCTACCG Pl.htrBcompl-EcoRI 20 ACCGGAATTCGTGTAACACTGGCATGGTGTA P2.htrBcompl-Ncol 21 CATGCCATTGTAGCAATCCGCTGTTGGTGCG EcoRV.Ery.F 22 AGCTTGATATCAGAGTGTGTTGATAGTGCAGTATC EcoRV.Ery.R 23 AGCTTGATATCACCTCTTTAGCTTCTTGGAAGCT BE2016 / 5444 EcoRV.Cm.F 24 AGCTTGATATCTGTGACGGAAGATCACTTCG EcoRV.Cm.R 25 AGCTTGATATCGGGCACCAATAACTGCCTTA Ori-1 26 CGGCATCAGAATAATACAAGCAGC Ori-2 27 AGGTGTACCGTGCTCTGGG virG-1 28 GTCACAGGTAACATGACTCTGGAG virG-2 29 CCATGTGTGAATACTACCTTCACCC ospD3-l 30 GTTTTGCCTCATTCAAGATATCACC ospD3-2 31 TGACGATGGTTTGTCAGGATTGC msbB. F 32 CGCCAAAGTTCCGTGATCCCATT msbB.R 33 CTCTTCGATGATCTCCAGCCCTT Production of S. flexneri lb, 2b, 3a and 6 Mutants of S. flexneri lb, 2b, 3a and 6 were prepared by adapting the methods described in [32]. Strains Shigella flexneri lb STANSFIELD, Shigella flexneri 2b 69/50, Shigella flexneri 3a 6885 and Shigella flexneri 6 10.8537 were chosen as parent strains. For the production of the mutants without virulence plasmids, a white colony was chosen by its white appearance on Congo red agar before the start of the genetic modification. The elimination of the virulence plasmid (pINV) was confirmed by the absence of the virulence genes encoded by the plasmid, particularly virG (primers 88/89) and mxiA (primers 53/54), using PCR. The primers are listed in Table 3. To produce the deletion of tolR in S. flexneri 1b, 2b, 3a, and 6, the kanamycin cassette was amplified from the plasmid pKD4 [32] using primers 45/46 (Table 3). The replacement of the tolR gene in strains carrying the plasmids pKD46 or pAJD434 was confirmed by PCR (primers 39/40). Elimination of the selective marker of the antibiotic a BE2016 / 5444 was carried out as described in [32], using the plasmid pCP20. The same strategy was used for the deletion of the htrB and msbB genes in these strains, using primers 49/50 and 51/52, respectively, for the amplification of the chloramphenicol cassette obtained by PCR from the plasmid pKD3 ( primers 45/46). Alternatively, replacement of htrB and msbB was performed using the fragment obtained from amplification of the chloramphenicol cassette with primers 78-81 and 74-77 (Table 3), respectively. The replacement of the htrB and msbB genes was verified by PCR using primers 82/83 and 55/56, respectively. The selective marker for chloramphenicol (cat) has been removed as described [32]. The strain NVGH2766 of S. flexneri 3a (S. flexneri 6885 AtolR :: kan, hmsbB :: cat) was produced. Table 3 Primers used in the production of mutants of S. flexneri lb, 2b, 3a and 6 Name ofThe primer SEQIDNO: 5'-3 'sequence 45-pKDF 34 CACGTCTTGAGCGATTGTGTAGG 46-pKDR 35 GACATGGGAATTAGCCATGGTCC 39-tolRsF 36 CAATTGGTCTGTTCGCCGC 40-tolRsR 37 CTACCGCACCTGAATCAACCA 47-tolRKOF 38 ACCGCCAGGCGTTTACCGTTAGCGAGAGCAACAAGGGGTAAGCCATGGCCGTGTAGGCTGGAGCTGCTTC 48-tolRKOR 39 ACCCGCTCTCTTTCAAGCAAGGGAAACGCAGATGTTTAGATAGGCTGCGTCATATGAATATCCTCCTTAG 49-htrBKOF 40 ACAATACATACAATTGCCCGTATAGGTTGAAAAACAGGATTGATATGACGGTGTAGGCTGGAGCTGCTTC BE2016 / 5444 50-htrBKOR 41 ATGCCGGATGCCATTCTGAAGCATCCGGCATGGGAGATTTAATAGCGTGACATATGAATATCCTCCTTAG 51-msbBKOF 42 ACTATCACCAGATTGATTTTTGCCTTATCCGAAACTGGAAAAGCATGGAAGTGTAGGCTGGAGCTGCTTC 52-msbBKOR 43 TTTTATTTGATGGGATAAAGATCTTTGCGCTTATACGGCTGGATTTCGCCCATATGAATATCCTCCTTAG 53-mxiAF 44 CGATAGGGATGTTGCCAGGTT 54-mxiAR 45 CTATCGGCACGCACCTCATTTA 55-msbB2F 46 CTTTCCCCTGTTTACTGGTTTACA 56-msbB2R 47 TGTCCGCGCTGGCAATG 7 4-msbBKOuF 48 AACCCGCGTCGAACTAATCC 75-msbBKOuR 49 CCTACACAATCGCTCAAGACGTGCGTTTCCATGCTTTTCCAGTTT 76-msbBKOdF 50 GGACCATGGCTAATTCCCATGTCCCCATCAAATAAAAAAGCCTCTCG 77-msbBKOdR 51 ATCCCGAGCATCAACGTTTC 78-htrBKOuF 52 GCGCAGTACCCAGAAGGAT 79-htrBKOuR 53 CCTACACAATCGCTCAAGACGTGGGTGGAGAACTTGGGTAGATTCG 80-htrBKOdF 54 GGACCATGGCTAATTCCCATGTCCCTTCACGCTATTAAATCTCCCA 81-htrBKOdR 55 TGACTACATCTACACCAGCCCT 82-htrBF 56 GCGTACTTTGGTTGGTCGTG 83-htrBR 57 AACGAAGGGCACCAGACA 88-virGF 58 GGTTATGATGGCTACGGTGGTA 89-virGR 59 GTTTATAGTCCTTCTGCGCCCA 7 4-msbBKOuF 60 AACCCGCGTCGAACTAATCC 75-msbBKOuR 61 CCTACACAATCGCTCAAGACGTGCGTTTCCATGCTTTTCCAGTTT 76-msbBKOdF 62 GGACCATGGCTAATTCCCATGTCCCCATCAAATAAAAAAGCCTCTCG 7 7-msbBKOdR 63 ATCCCGAGCATCAACGTTTC 78-htrBKOuF 64 GCGCAGTACCCAGAAGGAT 79-htrBKOuR 65 CCTACACAATCGCTCAAGACGTGGGTGGAGAACTTGGGTAGATTCG 80-htrBKOdF 66 GGACCATGGCTAATTCCCATGTCCCTTCACGCTATTAAATCTCCCA 81-htrBKOdR 67 TGACTACATCTACACCAGCCCT Shigella growing conditions The GMMA-producing Shigella sonnei and Shigella flexneri strains were routinely grown in defined S. sonnei medium (SSDM, [17]) with glucose as the carbon source. The SSDM was prepared as follows: 13.3 g / kg of KH 2 PO 4 , 4 g / kg of (NH 4 ) 2 HPO 4 , 1.7 g / kg of citric acid monohydrate, BE2016 / 5444 2.5 g / kg of L-aspartic acid, 493 mg / kg of MgSO4 * H2Û, 2.7 mg / kg of Co (NH3) gCl3, 15 mg / kg of MnCl2 * 4H2O, 1.5 mg / kg CuCl2 * H 2 O, 3 mg / kg H3BO3, 2.5 mg / kg Na2MoC> 4 * 2H20, 2.5 mg / kg zinc acetate monohydrate, 0.49 mg / kg ferric citrate, 50 mg / kg thiamine. Glucose was added at a concentration of 5 g / kg for cultures in solid medium and in shaken flasks. For growth in fermenters, 27.3 g / kg of glucose and 0.25 g / kg of polypropylene glycol (PPG) were added. The solid SSDM contained 18 g / l of agar. Shigella flexneri medium was further supplemented with amino acids, vitamins, and a higher concentration of iron. Preparation of cell banks To minimize the risk of contamination by transmissible spongiform encephalitis (TSE) or other accidental agents, the S. sonnei cell line and the S. flexneri cell lines were cleaned according to GMP by three passages on plates of agar prepared with SSDM. Vials of master and working cell banks are prepared according to GMP. Flow cytometry of bacteria or GMMA Shigella bacteria originating from a fermentor or from a culture on the scale of the flask were preserved for a flow cytometry analysis by fixation in 0.5% formaldehyde. 9 x 10 4 to 9 x 10 5 cells were stained with a monovalent rabbit antiserum (Denka Seiken Co., Ltd.), reacting with the O antigen (AgO) or a polyclonal mouse antiserum directed against the GMMAs formulated with ALHYDROGEL® BE2016 / 5444 for Shigella serotypes. Bound antibodies were detected using an anti-rabbit goat F (ab ') 2 fragment or fluorescein-conjugated anti-mouse IgG, IgM or IgA (Jackson ImmunoResearch Europe Ltd.). The samples were fixed using 4% formaldehyde and analyzed using a FACScantoTM II flow cytometer (BD Biosciences). The data was processed using FlowJo software (Tree Star Inc.). GMMA production The following descriptions are based on the 1790-GMMA production of S. sonnei. When the process differs for the production of GMMA from S. flexneri, additional guidance is given. Fermentation For each production batch, the Shigella strain was cultivated in an agitated flask obtained from the Research cell bank or from GMP in SSDM at 30 ° C. with agitation (200 rpm), starting from a optical density measured at 600 nm (D0600) of 0.02 until the culture has reached an D0600 equal to 1.5 ± 0.5, usually in 9 ± 2 hours. In the bioreactor (30 1 scale in the Biostat D75 bioreactor of Sartorius or 25 1 scale in the LP35 bioreactor of Bioengineering), the strains are cultivated in closed mode, starting from an inoculum size of 2% with controlled culture conditions: pH 6.7 maintained by the addition of NH 4 OH at 28%, 30 ° C, dissolved oxygen maintained at 30% saturation by an air flow of 1 volume of air by BE2016 / 5444 culture volume per minute (vvm), stirring and cascade pressure (200 to 800 rpm, 50 to 1250 mbarg) until the final D0600 of 35. Purification The GMMAs released in the fermentation broth were purified using two consecutive stages of tangential flow filtration (TFF): a microfiltration in which the culture supernatant containing the GMMAs is separated from the bacteria, and an ultrafiltration, in which the GMMAs have been separated from soluble proteins. For the microfiltration stage (1.2 m 2 of cellulose membrane with a pore size of 0.2 μm), the bioreactor was connected to the TFF system, in order to use the fermentation vessel as a recirculation tank . The culture supernatant was initially concentrated three times to reach "one volume" of concentrated supernatant, this followed by a discontinuous diafiltration against five volumes of the buffer in the growth medium (13.3 g / kg of KH 2 PO 4 4 g / kg NH 4 HPO 4 ; 1.7 g / kg citric acid; 4 ml / 1 NH 4 OH; pH 6.7). Physiological saline can also be used. The microfiltered material, containing the GMMAs, was then filtered through a filter capsule with 0.45 μm and then 0.2 μm filters (Sartorius) to ensure the absence of any viable Shigella bacteria before another treatment. The ultrafiltration step (1.4 m 2 of PES membrane with a pore size of 300 kDa) consisted of a concentration followed by a discontinuous diafiltration of the microfiltered solution of GMMA against ten volumes of physiological serum BE2016 / 5444 buffered with Tris (TBS), 0.9% NaCl, 10 mM Tris / Tris HCl pH 7.4 or 0.9% w / v sodium chloride, and allowed substantial elimination of acids nucleic acids and soluble proteins. A final concentration of purified GMMAs was carried out to obtain the concentration required for the formulation treatment and filtered through a sterilizing filter in Sartorius cellulose acetate which was validated for the capacity of retention of extractable, leachable products and of bacteria with the bulk of GMMA. Three batches of GMMA of S. sonnei non-GMP compliant were prepared from a fermentation volume of 30 1. In addition, two batches of GMP were produced and released to further support the manufacture of toxicology and clinical vaccines . The bulk GMMAs of S. sonnei were tested for their appearance, their identity, their total and soluble protein content, their O antigen content, their LPS content, their pH, their osmolality, their purity and their size. Formulation The GMMAs were adsorbed on aluminum hydroxide (ALHYDROGEL® 2%, Brenntag Biosector, Denmark) by adding the suspension of GMMA to ALHYDROGEL® with constant stirring at room temperature for 2 h, followed by bottling. . The GMMA-ALHYDROGEL® formulation contains 12.7 pg / ml of S. sonnei O antigen, 200 pg / ml of GMMA proteins and 0.7 mg / ml of aluminum-III ions (Al 3+ ) as ALHYDROGEL® in TBS. A histidine buffer can also be used. The formulation was dispensed at 0.7 ml per 3 ml single dose vial. The BE2016 / 5444 formulation was tested for identity, total protein content, aluminum content, volume of extractable compounds, non-adsorbed proteins, visual appearance, pH, osmolality, sterility, l immunogenicity, and pyrogenicity. Three GMP lots of S. sonnei 1790GAHB, one toxicology lot and two clinical lots, were prepared and released. A smaller non-GMP stability batch (140 ml) was also produced. Freshly formulated small-scale laboratory batches were produced for initial studies of pyrogenicity and immunogenicity. GAHB-Placebo GMP formulation A placebo, also used as a diluent, was prepared containing 0.7 mg / ml of Al 3+ as ALHYDROGEL® in TBS and was distributed to 0.7 ml per 3 ml vial. A histidine buffer can also be used. GAHB-Placebo has been tested for its identity, its aluminum content, its volume of extractable compounds, its visual appearance, its pH, its osmolality, its sterility and its pyrogenicity. Two GMP batches of GAHBPlacebo were produced and released. Physico-chemical analytical procedures Quantification of GMMA proteins The GMMAs produced from the NVGH1790 strain are called 1790-GMMA. Protein quantification was performed routinely by the Lowry assay. For the determination of the GMMA protein concentration, the assays used a secondary standard of BSA calibrated as described above [28] against a primary standard of 1790-GMMA with a content BE2016 / 5444 in proteins determined by a quantitative analysis of amino acids. Thus all the protein concentrations of GMMAs are indirectly referred to the protein concentration determined by the analysis of amino acids. Samples containing Tris were diluted to a final Tris concentration of 1 mM or less to avoid interference with the Lowry assay. The microBCA assay can also be used for the quantification of GMMA proteins. Quantification of GMMA proteins formulated with ALHYDROGEL® For the quantification of the GMMA proteins adsorbed on ALHYDROGEL® (for example, 1790GAHB), the Lowry assay or microBCA is also used, and the secondary standard of BSA was adsorbed on ALHYDROGEL®. After the color development, the samples were centrifuged and the absorbances of the supernatants were determined. Soluble proteins not adsorbed on GMMA preparations were determined in the supernatant of the ALHYDROGEL® formulations after ultracentrifugation at 186,000 g at 4 ° C for 2 h using a secondary standard of BSA calibrated against a primary standard of soluble quantified proteins. by quantitative analysis of amino acids. The content of unbound proteins in GMMAs adsorbed on ALHYDROGEL® was too low to be measured by the Lowry or microBCA assay and was estimated to be the limit value of the test by SDS-PAGE (bis-acrylamide gel at 10 %) supernatants BE2016 / 5444 collected after centrifugation of the sample and compared with a series of reference 1790-GMMA in a parallel corridor. The protein bands were visualized by silver staining, quantified by densitometry and the data were analyzed using ImageScanner III software. The intensity of the detectable bands in the supernatant sample was compared (as the limit value of the test) with the intensity of the corresponding bands in the 1790-GMMA sample. The limit corresponds to 5 pg / ml of non-adsorbed proteins (2.5% of the total proteins of the 1790GAHB formulation). GMMA protein profile The 17 90-GMMAs were denatured for 10 min at 100 ° C. in sample buffer for polyacrylamide gel electrophoresis with sodium dodecyl sulfate (SDS-PAGE) containing SDS (Invitrogen, LDS sample buffer NuPAGE) and 50 mM dithiothreitol (DTT). 3 μg of proteins were loaded onto a 10% (w / v) polyacrylamide gel (Invitrogen, Novex 10%). The electrophoresis was carried out in 3- (N-morphoiino) -propanesulfonic acid (MOPS) buffer (Invitrogen) at 40 mA for 75 min. The separated proteins were stained with brilliant blue G of Coomassie colloidal (Sigma-Aldrich), quantified using densitometry and analyzed using ImageScanner III software. The protein profiles of the test samples were compared to the profiles of the reference GMMAs subjected to electrophoresis on the same gel. Quantification of the O antigen in GMMAs BE2016 / 5444 For a detailed characterization and the batch release tests, the concentration of the O antigen (AgO) was measured by an HPAEC-PAD analysis. The quantification determines the weight in mg of the total AgO present in the sample. O antigen reference standard: GMMAs from S. sonnei NVGH1859 (1859-GMMA) were hydrolyzed for 2 h at 100 ° C. in 1% acetic acid. The cleaved lipid A and the precipitated proteins were each removed by centrifugation [21]. The main fraction (mean molecular weight, PMM) of AgO was recovered by exclusion chromatography (SEC, column GE Sephacryl S-100HR). The size of the AgO was determined by measuring the number of repeating units by 1 H NMR [22]. The average was 33. The amount of O antigen was determined from the average number of repeating units and the molar concentration of the heart of LPS by galactose measured by an HPAEC-PAD analysis as described above and in Quantification of the LPS below. Alternatively, the quantification of AgO can be performed by quantitative 1 H NMR (qRMN) using maleic acid as an internal standard. Quantification of the O antigen in GMMAs: the LPS was purified by hot extraction with phenol-water [23] as follows: 400 μΐ of sample were added to an equal volume of 90% phenol solution pH 8 (Sigma-Aldrich) and incubated at 80 ° C for 2 h. After cooling to 4 ° C, the sample was centrifuged at 18,000 g at 4 ° C for 15 min and the upper aqueous phase containing the LPS was recovered. The BE2016 / 5444 phenolic phase was again extracted with 400 μΐ of water (1 h at 80 ° C) and after centrifugation (18,000 g at 4 ° C for 15 min), the aqueous phase was recovered, combined with the first aqueous extract and dried overnight in a centrifugal evaporator. The sample was reconstituted in water (400 μΐ) and optionally diluted with water to give a concentration of O antigen between 2.5 and 30 pg / ml. The LPS yield was> 90% as judged by the recovery of the LPS core, measured using galactose as described above. The LPS was subjected to alkaline hydrolysis and the sugars were measured by an HPAEC-PAD analysis as reported for the polysaccharide Vi [40] and compared to the reference standard for antigen O. Quantification of LPS in GMMA Quantitative determination of central galactose sugar by HPAEC-PAD analysis [21] was used to quantify the amount of LPS in 1790-GMMA based on two galactoses per core [22]. The quantification determines the number of moles of LPS molecules. A series of dilutions of galactose standards is performed in each analysis. The 1790-GMMA and galactose standards are treated in parallel with 2 M trifluoroacetic acid for 4 h at 100 ° C. The samples are cooled to a temperature between 2 and 8 ° C, dried overnight, redissolved in water, filtered and analyzed. The HPAEC-PAD analysis is carried out on a Dionex ICS3000 instrument using a CarboPac PA10 column and a PA10 guard column. The separation is BE2016 / 5444 performed using an isocratic elution condition with 18 mM NaOH. For the GMMAs of S. flexneri, as a general method for the quantification of LPS, the quantification of the 3-hydroxylated fatty acids present in the form of ester in a lipid structure is used. By alkaline hydrolysis of the sample followed by HPLC-RP-QqQ (SRM), the quantification is carried out using a 3-OH fatty acid standard to construct the calibration curve. Distribution of LPS sizes in GMMAs For screening purposes, an SDSPAGE analysis can be used. The LPS was purified using the phenol-water process (see above) with modifications. The GMMAs (1 mg / ml) were brought to the boil for 3 min, incubated with 0.5 μg / μl of proteinase K (Sigma Aldrich) at 60 ° C. overnight, mixed in a ratio of 1/1 (vol / vol) with saturated phenol pH 8.0 (Sigma Aldrich), incubated for 30 min at 70 ° C, and centrifuged for 1 h at 10,000 g at room temperature. The upper phase was recovered, mixed in a ratio of 2/1 (vol / vol) with 100% ethanol, the LPS was precipitated for 1 h at -80 ° C and transformed into pellet by centrifugation at 12 000 g for 30 min at room temperature. The pellet was dried using a SpeedVac and dissolved in water. The LPS was electrophoresed on 12% polyacrylamide bis-tris gel (Life technologies) and stained using the Silver Quest ™ silver staining kit (Life Technologies). For more characterization BE2016 / 5444 specifies, HPLC-SEC analysis can be used. Lipid A and proteins are removed from the test sample by hydrolysis with 1% acetic acid (2 h at 100 ° C) / centrifugation at low speed (14,000 rcf for 5 min); the dried (or desalted) supernatant is injected into the HPLC using a TSK-GEL® 3000 PW column with refractive index detector. The molecular size is determined by the GPC software using PM standards of dextrans. If the sample is derivatized with semicarbazide, the resulting peak can be used to confirm the amount of AgO. MALDI-TOF analysis of lipid A in bacteria or GMMA The identity test of lipid A by the process of desorption and ionization by laser assisted by time of flight matrix (MALDI_TOF) determines the type of lipid A in the LPS. Lipid A was precipitated from GMMAs or bacterial cell banks as previously described [20] using mild acid hydrolysis with 1% acetic acid for 2 h at 100 ° C. The samples were centrifuged at 14,000 xg for 15 min, the pellets were resuspended in water, and washed twice with water. The pellets were dried overnight using Speedvac and resuspended in chloroform-methanol (4/1) and mixed with an equal volume of Super DHB solution (Sigma-Aldrich) in water / acetonitrile (1 / 1, vol / vol). Two μΐ of the mixture were loaded onto the target plate (BC steel conduction target plate BE2016 / 5444 MTP 384, Bruker Daltonics) and analyzed by an Ultraflex MALDI-TOF instrument (Bruker Daltonics) in reflectron negative ion mode. A peptide calibration standard (Bruker Daltonics), mixed with Super DHB solution, was included in each analysis. The m / z ratios were determined by Flex Analysis software compared to the peptide standard. The lipid A species is identified by comparison of the mass m / z of the molecular peak with what is expected for the samples. GMMA particle size Dynamic light scattering determines the size distribution of GMMAs using a Zetasizer Malvern Nano ZS ™. The particle size distribution was obtained in the form of the intensity of the scattered light using the mean value of Z of the three different measurements of the back light flared at an angle of 17 3 ° with "Proteins" as setting. material and "General objective (normal resolution)". The diameter obtained by this technique is a sphere which has the same translational diffusion coefficient as the particle measured. The size is expected to be different from that measured by electron microscopy and will be a valid measure of the range of particle sizes and homogeneity of manufacturing. Negative staining transmission electron microscopy was also used to estimate the size of the GMMA particles. GMMAs were prepared and observed by electron microscopy as previously described [20]. The electron micrographs were recorded at a nominal magnification of 105,000 X. The diameters of the GMMA were measured manually on copies BE2016 / 5444 printed compared to technique used electronic micrographs the scale bar. Another to determine the size that best corresponds to the data obtained by electron microscopy is the HPLC-SEC coupled to the MALLS (multi-angle laser light scattering) using TSKGEL® 6000PW and 4000PW columns connected in series. Identity and quantification of the GMMA O antigen formulated with ALHYDROGEL® The identity of GMMAs formulated with ALHYDROGEL® can be determined by technologies based on immunology. The ALHYDROGEL® Formulation Direct Immunoassay [31] was used with modifications. The identity of the GMMAs is confirmed by the detection of the O antigen present in the formulation using a commercial typing of antisera produced in rabbits or a typing of monoclonal antibody produced in mice. An aliquot of the GMMAALHYDROGEL® suspension is blocked with BSA and incubated with the specific antibody for AgO. The binding of the typing antibody is then detected using an anti-rabbit antibody or an anti-mouse antibody labeled with an enzyme. The presence of the immunologically reactive O antigen is detected by the addition of a substrate solution and the formation of a color which can be detected by absorbance. BE2016 / 5444 Identity is confirmed by comparing the absorbance of the sample to be tested with the absorbance of a reference included in the same test. The identity and quantification of the O antigen can also be carried out by a competitive ELISA test. The working principle is based on the competition between the O antigen or the specific LPS of Shigella and the GMMAs formulated with ALHYDROGEL® for the binding to a monoclonal antibody specific for a serogroup or to a polyclonal antiserum. The more GMMAs are present in the suspension, the less monoclonal or polyclonal antibodies can bind to the antigen-coated plate, and the less signal can be detected by standard ELISA methods. The O antigen present in the formulation to be tested is quantified compared to the signals obtained with a calibration curve constructed by overloading the monoclonal antibody with a known amount of GMMA formulated with ALHYDROGEL®. Biological tests Isolation of CMSP and MAT test In vitro production of interleukin 6 (IL-6) by PBMCs following stimulation with GMMAs was used as an in vitro surrogate to estimate the reactogenic potential using the procedure described by Rossi et al. [20]. In short, buffy coats from different donors have been used to isolate PBMCs using Ficoll density centrifugation as reported [24]. The PBMCs were seeded at a density of 2 x 105 eelluie / well with 180 μΐ of RPMI53 BE2016 / 5444 1640 supplemented with 25 mM HEPES, 2 mM glutamine, 10% FBS, 1% penicillin-streptomycin (InvitroGen) in 96-well round bottom plates. 20 μΐ of serial dilutions to 1/10 of GMMA in TBS (0.0001 to 1000 ng / ml of final concentration in the test) were added, the cells were incubated for 4 h at 37 ° C and the supernatants were collected after centrifugation (5 min, 400 g) and stored at -80 ° C until analysis for the concentration of IL-6. Immunogenicity / potency studies in mice Eight BALB / c or CD-I mice per group (females, 4 to 6 weeks of age) received one or two intraperitoneal injections of different doses of GMMA formulated with ALHYDROGEL on days 0, and 21 in a volume of 0.5 ml. Control mice received 0.5 ml of GAHB-Placebo. Blood samples were taken on days 7, 14, 21, 28, 35 or in some studies, only on day 21. In power tests, groups of mice were immunized with four different doses of the vaccine or 'power standard (GMMA reference, stored at -80 ° C, and freshly formulated on ALHYDROGEL). ELISA (enzyme-linked immunosorbent assay) test Antibodies raised against GMMA's S. sonnei or S. flexneri are estimated by an ELISA test using the LPS of Shigella sonnei or the O antigen of the S. flexneri serogroup as the plaque coating antigen. Nunc ™ Maxisorp ™ 96-well plates were coated overnight at 2-8 ° C with 0.5 µg / ml of BE2016 / 5444 LPS or <5 pg / ml AgO in phosphate buffer solution (PBS). The plates were blocked for 1 h with 5% milk in PBS and then washed three times with PBS containing 0.05% TWEEN® 20 (PBST). Mouse sera were diluted 1/100 and 1/4000 in PBST with 0.1% BSA, rabbit sera were diluted in 5% milk in PBS. The diluted sera were incubated in triplicate for 2 h in the ELISA plates. The samples were tested in comparison with standard sera previously established and calibrated anti-LPS of S. sonnei or anti-antigen O of serotype of S. flexneri included in a series of duplicates on each of the plates. After incubation with the sample and the reference sera, the plates were washed three times as above. Bound antibody was detected using anti-mouse goat IgG or anti-rabbit goat IgG conjugated with alkaline phosphatase, diluted in PBST, followed by three washing steps and a color reaction with p-nitrophenyl phosphate substrate. After 1 h, the absorbance (optical density, OD) was measured at a wavelength of 405 nm and 490 nm and the OD405 nm-490 nm was calculated. The results are expressed in ELISA units determined relative to the standard serum. An ELISA unit is equivalent to the inverse of the dilution of the standard serum giving an OD405 nm-490 nm of 1 in the assay of the standard. Determination of the bactericidal power of the serum as a measure of the functionality of the antibodies BE2016 / 5444 The bacteria S. sonnei and S. flexneri were cultivated up to the logarithmic phase (OD: 0.2), diluted 1/15 000 in PBS and distributed in sterile polystyrene microtiter plates with U-shaped bottom. 96 wells. In each well, samples of the sera diluted in series from 1/8 to 1/12 were added (starting from a 1/100 dilution in the well). Before use, the sera were heated at 56 ° C for 30 min to inactivate the endogenous complement. Active baby rabbit supplement (BRC, Cederiane CL3441 lot 6288) used at 7 to 20% of final volume was added to each well. The source, batch and percentage of BRC used in the reaction mixture of the SBA test were chosen beforehand for low toxicity against each specific bacterium. To assess possible non-specific inhibitory effects of BRC or mouse serum, the bacteria were also incubated with the same sera tested plus heat-inactivated BRC; sera alone (no BRC); the SBA test buffer and active BRC. After 3 h of incubation in the SBA test mixture, the inhibition of bacterial growth was measured. The bactericidal activity was measured in terms of serum titers, which are defined as the dilutions of sera necessary to obtain 50% of bacterial growth. Serum titers equal to 10 were given when no bactericidal activity was detected. Pyrogenicity We have established a modification of the pharmacopoeia intravenous pyrogenicity test method BE2016 / 5444 European (Ph. Eur. 2.6.8 pyrogens, [25]) using the administration of a whole human dose administered intramuscularly. Two sets of experiments were carried out to establish the test. In the first experiment (in non-GMP conditions but in a GMP establishment), three groups of 3 rabbits, preselected according to the criterion Ph. Eur. 2.6.8 pyrogens, were placed in retention boxes and body temperatures were recorded using a rectal probe and the initial temperature was determined. The batch of toxicology vaccine (0.5 ml) was injected intramuscularly into each of the three rabbits in two vaccine groups and 0.5 ml of sterile saline into the three rabbits in the control group. The temperature was continuously recorded by an automated system from 90 min before injection until 3 h after administration to determine the initial temperature and a possible rise in temperature after administration. The temperature was recorded manually at 3.5, 4, 5, 5.5, 6, 6.5 and 7 hrs. The following day, the rabbits were again placed in the holding box, allowed to acclimatize and another reading was taken at 24 h. Based on the data (see Results), the following test was chosen for the intramuscular pyrogenicity test for 1790GAHB. Two groups of three rabbits, (a test group for the vaccine and a control group), are chosen according to the criterion Ph. Eur. 2.6.8, placed in retention boxes and the initial temperature was determined using a BE2016 / 5444 rectal probe. The vaccine (0.5 ml) is injected intramuscularly into rabbits in the vaccine group and 0.5 ml of sterile saline into rabbits in the control group. The temperature is continuously recorded by an automated system for 3 h and additional readings are taken manually at 3.5 and 4 h. The maximum temperature rise for each rabbit is determined (the difference between the highest temperature measured during the 4 h period after administration and the initial temperature). For the test to be valid, the average of the maximum temperature rise of three controls must be ^ 0.3 ° C. The test passes if the average of the maximum rise in temperature of the three rabbits in the test group for the vaccine is <0.8 ° C, and fails if the average of the maximum rise in temperature is 1.2 ° C. The test will be repeated if the average of the maximum temperature rise of the three rabbits is> 0.8 but <1.2 ° C. For the repetition of the test in 3 additional rabbits, the test will pass if the average of the maximum rise in temperature of the three rabbits is 0.8 ° C and otherwise it will fail. The second study was carried out under GMP conditions in the GMP establishment using the above criteria to estimate the pyrogenicity of batches of toxicology and clinical vaccines. The temperature record in the study was extended over a 24 h period to provide further data on the reliability of the test and the choice of 4 h as the definitive time period to estimate the rise in temperature. BE2016 / 5444 The IM pyrogenicity test method was used to release three GMP lots of 1790GAHB from S. sonnei. Study of the toxicology of repeated doses To support clinical administration of up to three immunizations of the 17 90GAHB S. sonnei vaccine, a toxicology study was conducted with New Zealand White rabbits in accordance with Good Laboratory Practice (GLP) standards. (WIL Research Europe, Lyon, France). The vaccine was administered four times, two weeks apart by the intramuscular (IM), intranasal (IN), or intradermal (ID) route, followed by a two-week observation period. Rabbits were chosen as the animal model based on preliminary research studies demonstrating the ability to produce an immune response. The design of the study is presented in Table 3. All the animals were observed during the study for morbidity / mortality, clinical observations / examinations, injection sites (Draize test), ophthalmology, body weights, food consumption. Clinical pathology, including coagulation parameters and reactive protein C (pre-test, on day 2 and at two necropsies), antibody analysis (pre-test, pre-dose and at two necropsies), gross observations at necropsies, weights organs, and histopathology (WHO complete tissue list) were all performed in all groups. Body temperatures of groups 2 and 5 (MI) at first immunization were measured at 1.5 h, 0.5 h, and 2 min (0 h) before the administration of BE2016 / 5444 the dose and at 0.5, 2, 6, and 24 h after the injection. The mean temperature at -0.5 h and Oh was considered the initial temperature of the rabbits. In the 2nd, 3rd, and 4th group 2 immunizations and 5 and at all immunizations of groups 1, 3, 4, 6, and 7, the body temperatures were recorded before (Oh), and 2, 6, and 24 h after the administration of the dose. Table 3 Experimental design of the toxicology study Group/Treatment Path (s) a Antigenbyinjection(pg of AgO /pg ofproteins) Volume ofthe dosebyinjection(pl) Number of animals Necropsied atday 44 Necropsied atday 56 Males Females Males Females lb 0.9% ofNaCl IM IN C ID 0 50040050 4 4 4 4 2 GAHB-Placebo IM 0 500 4 4 4 4 3 G7VHB-Placebo IN 0 400 4 4 4 4 4 GAHB-Placebo ID 0 50 4 4 4 4 5 1790GAHB IM 6.1 / 100 500 4 4 4 4 6 1790GAHB IN 4.9 / 80 400 4 4 4 4 7 1790GAHB ID 0.61 / 10 50 4 4 4 4 Day of dose administration: 0, 14, 28 and 42. a MI: intramuscular; IN: intranasal; ID: intradermal. b Each animal in group 1 (control) received sterile physiological saline (0.9% NaCl) by the three routes. c 4 administrations of 100 μΐ per nostril 2 hours apart, that is to say 400 μΐ / day. The nostrils were alternated between vaccinations. BE2016 / 5444 Study Irwin in rats with a vaccination IN For again support the IN administration of 1790GAHB, a test GLP of Irwin was undertaken to identify the effects unwanted potentials of 1790GAHB on the system central nervous and peripheral judged by a drums observations neurobehavioural [26]. Three groups of 6 male Han Wistar rats, approximately 0.3 kg, were used. The first group received the saline control, the second the GAHB-Placebo and the third the 17 90GAHB. Each rat received a single dose of 15 μΐ in each nostril (total of 30 μΐ). This administered volume was the maximum practical dose. The test group received a total of 6 µg of 1790GAHB protein. Based on body weight, the 6 pg dose of protein in a 0.3 kg rat is approximately 15 times the highest expected dose to be administered IN to a 60 kg subject in the Phase trial 1. The rats were followed, before and at 0.5, 1, 2, 5, and 24 hours after administration. All animal studies have complied with EU Directive 2010/63 on the protection of animals for scientific purposes, and its implementation in relevant local laws in Italy and France, respectively. The modified GMP pyrogenicity test was approved by the Charles River France ethics committee (Study number T 13.1446-48, T 13.1678-80, T 13.1702). Results BE2016 / 5444 Expression of the O antigen of the cell line NVGH1790 by S. sonnei The strain NVGH1790 was genetically modified by the integration of the nadA and nadB genes of E. coli in the virulence plasmid to eliminate nicotinic acid auxotrophy from Shigella [18]. Thus, the retention of the virulence plasmid and therefore the production of the AgO encoded by the plasmid [27] is ensured by growth in a medium without nicotinic acid. FACS analysis of S. sonnei NVGH1790 after 25 generations in flasks and after fermentation of 30 l showed that> 95% of the bacteria were positive for AgO, thus showing the retention of this plasmid. Pilot-scale production and characterization of the 1790-GMMA Three series of 30 1 uniformity were performed. For each batch, the fermentation process optimized at 30 1 was stopped when the D0600 was approximately 35, in 20 ± 4 hours from the inoculation of the bioreactor, when an overload of dissolved pC> 2 occurred and that the pH started to rise. At the end of the fermentation, the culture was harvested by microfiltration. Then the GMMAs were purified by ultrafiltration. The process was transferred to a manufacturing organization under external contract for the production of two GMP batches of 17 90GMMA. The GMP batch was produced on a scale of 25 1. The data are presented for one of the uniformity batches produced at NVGH, the batch of 1790-GMMA NVGH1883 (reference batch), and for the BE2016 / 5444 two GMP medicinal substances, lot 1112 and lot 1014 of 1790-GMMA. GMMA yield and characterization Size and integrity By electron microscopy, the purified GMMAs from the references and from the GMP batches presented particles with a bimodal size distribution. The majority of the particles are small with an average size of approximately 25 to 40 nm in diameter. A minor fraction of the particles was larger with sizes between 65 and 140 nm (16% of the particles). Dimensional analysis by dynamic light scattering (DDL) using a Zetasizer Malvern Nano gave an average Z value of 117 nm, 113 nm and 116 nm for the reference and the two GMP batches, respectively. Results for the polydispersity index of 0.19, 0.21 and 0.20 were obtained for the reference and the two GMP lots, respectively. Importantly, the DDL results were unchanged by multiple freeze / thaw cycles or storage at -80 ° C indicating that the GMMAs remained intact and did not aggregate under these conditions. Thus, the 1790-GMMA were stored routinely at -80 ° C before formulation. Yield The reference and the two GMP batches gave a final yield of 2.4 g of protein (from 30 l), 1.7 g of protein (from 25 l) and 0.42 g of protein ( from 25 1) in purified GMMAs, respectively. These lots contained 145 mg, BE2016 / 5444 106 mg and 25 mg AgO, respectively, with almost identical AgO protein ratios (60.3 pg / mg, 63.6 pg / mg and 59.0 pg / mg). The other two batches of uniformity (from 30 l) were similar: yield, 2.0 g and 3.2 g; AgO protein ratio, 61.6 pg / mg and 50.3 pg / mg, respectively. Protein profile The SDS-PAGE profile of the 1790-GMMA proteins was similar to that observed in previous studies [22,36]. Dominant bands at a size of approximately 39 kDa were identified as OmpA and OmpC by mass spectrometry analysis. Profile of LPS and O antigen The silver stained SDS-PAGE of the LPS extracted from the reference and from the GMP batches showed an LPS scale with a bimodal distribution (data not shown). The predominant bands were low molecular weight LPS with up to 5 repeats of AgO; LPS of average molecular weight was visible as a minor fraction. These data were consistent with the analytical exclusion chromatography of the AgO / extracted heart using the refractive index detection (data not shown). The dominant peak was the low molecular weight polysaccharide. This size distribution of LPS mainly of low molecular weight in the 1790-GMMA is markedly different from the size in the reference LPS derived from the parent strain without the modification of the LPS (1859-GMMA) which has an average of 33 repetitions measured by NMR. BE2016 / 5444 The composition of the LPS core was determined by an HPAEC-PAD analysis. This process demonstrated that the molar ratio of galactose to glucose in LPS present in 1790-GMMA is 2/4, while in GMMA from the parent strain without modification of LPS (1859-GMMA) ratio was 2/3 and similar to wild type strains of S. sonnei [22]. The change in glucose content in the LPS heart of 17 90-GMMA was confirmed by an analysis of a third LPS heart sugar, the terminal KDO. In 1790-GMMA and 1859-GMMA, the ratio of galactose to KDO was identical. The glucose to KDO ratio was delayed confirming a higher glucose content in the LPS core of 1790-GMMA. Structure of lipid A The structure of lipid A purified from the reference batch was determined by mass spectroscopy using MALDI-TOF (data not shown). The spectra recorded showed a pentaacylated lipid A corresponding to the highest peak and to several other peaks due to its fragmentation (i.e., the loss of one or more chains of fatty acids), to the formation of aggregates with sodium (+23 m / z) and dephosphorylation (-80 m / z). No hexa- or hepta-acylated lipids A were detected by MALDI-TOF. Production of IL-6 in the MAT test 1859-GMMAs containing unmodified LPS induced high IL-6 release rates from PBMCs, causing a 10-fold increase in IL-6 release compared to background noise at a BE2016 / 5444 concentration of 0.004 ng protein / ml, while 1790-GMMA, containing a penta-acylated LPS, required a concentration 600x higher (2.37 ng protein / ml) to cause the same release of IL -6. Intramuscular pyrogenicity test The average increases in temperature observed at the various intervals up to 7 h, and at 24 h after vaccination in the 12 rabbits receiving the GMMA vaccines (6 in the first study receiving the toxicology batch, 3 in the second study receiving the toxicology batch and 3 receiving the clinical batch) are represented in FIG. 1 compared to the average increase in temperature of the 6 animals receiving physiological saline. The mean increase in temperature in the vaccine group increased further at the normal end point of 3 hours for an intravenous pyrogenicity test. After 5 h, the average temperature increase in the control animals showed a significant increase and the difference between the vaccine and control groups decreased. At 24 h, the vaccine and control groups were not significantly different (the vaccine group had a lower mean temperature increase). Based on these results, 4 h was chosen as the final time point. Using the criteria developed as detailed above, the toxicology group and the two clinical vaccine groups passed the pyrogenicity test without requiring a repeat of the test. "The average increase in maximum temperature" on the BE2016 / 5444 first hours after administration of the toxicology batch and the two clinical batches were 0.48 ° C, 0.53 ° C and 0.40 ° C, respectively. For the control groups, the value was 0.27 ° C. Toxicology study There were no deaths, no clinical signs associated with treatment, and no change in body weight or food consumption in rabbits treated with the 1790GAHB vaccine or GAHB-Placebo. There were no ophthalmologic observations associated with the treatment. No change in organ weight considered to be associated with the administration of either the vaccine or placebo was noted on day 44 or day 56 (i.e., 2 or 14 days after final vaccination ). The vaccine was locally well tolerated by the intranasal and intramuscular routes with no local reaction observed by the IN route and very mild local reactions (erythema, edema) to moderate (edema) observed in some of the rabbits after IM administration . ID administration induced very mild to moderate local reactions (induration, erythema and edema) which were not more pronounced in the 17 90GAHB group than in the corresponding GAHB-Placebo group. Local reactogenicity was completely or partially resolved at the end of the two-week recovery phase at the IM injection sites but not at the ID injection site. However, tolerance to the vaccine by ID administration remained acceptable. Inflammatory changes of low severity and amplitude including in the lymph nodes BE2016 / 5444 significant receiving the drainants and the spleen were noted during the histopathological examination; these changes correlated with increases in reactive protein C and fibrinogen and were consistent with this pharmacological response to an immunogen. Changes in clinical pathology parameters and minimal to moderate microscopic changes were generally resolved at the end of the recovery period in the IN and ID treated groups while those observed in the IM treated group decreased slightly, indicating that recovery from inflammatory changes was underway. There was a statistically increased temperature in 1790GAHB rabbits by IM compared to the placebo groups by IM. This was only observed for the IM groups and mainly in males. After the first IM vaccination, there was an average temperature increase of 0.43 ° C for the 1790GABH versus 0.12 ° C for the placebo (p = 0.009, t-test) at 2 hours and 0.64 ° C for 1790GAHB versus 0.38 ° C for placebo (p = 0.005, t-test) at 6 hrs compared to pre-vaccination. At 24 h after the injection, there was no difference in these groups (increases of 0.21 and 0.22 ° C compared to the initial temperatures before vaccination, respectively). Similar increases in temperature were observed in the IM groups following the 3rd and 4th injections (temperature increases of 0.44 versus 0.11 ° C and 0.63 versus 0.33 ° C at 6 a.m. compared to the BE2016 / 5444 pre-vaccination for 1790GAHB against placebo). A smaller but statistically insignificant increase was observed following the second immunization (0.28 versus 0.14 ° C at 6 hrs compared to pre-vaccination). While the differences were considered to be associated with 1790GAHB, given the very small amplitude of the variation and the short period of increases, the effect was not considered to be toxicologically relevant. Irwin's study Irwin's study in rats to estimate the neurotoxic effects of IN vaccination following a single administration of 1790GAHB showed no relevant effect on a battery of behavioral and physiological parameters covering the main functions of the nervous system central and peripheral. Immunogenicity and potency in mice The initial immunogenicity study evaluated 7 different doses of 1790GAHB increasing by 4 times from 29 ng to 238 pg of protein (1.75 ng to 14.35 pg of AgO) intraperitoneally and showed that the vaccine has was highly immunogenic. The antibody was detectable at all doses after a single injection and was reactivated following a second injection. 1.86 pg protein (0.11 pg AgO) elicited the maximum antibody response. Based on these results, an immunogenicity protocol was developed to form the basis of power tests and to estimate the stability over time, judged by the power. The final design of the power study used BE2016 / 5444 four doses 4-fold increase in 1790GAHB from 29 ng to 1.86 pg of protein in groups of 8 mice with serum IgG levels estimated by an LPS ELISA test with homologous AgO three weeks after a single immunization. A reference preparation of 1790GAHB was freshly formulated for each potency study, and administered at the same doses as the vaccine to be tested. The dose-response curves of the levels of antibodies raised by the test vaccine and the reference standard were compared. There were no significant differences in the slope or intersection responsible for the linear regression of the anti-LPS antibodies transformed into log on the dose in log showing that the vaccine stability batch had the same potency than the freshly formulated reference material. Immunogenicity in rabbits The IgG response in rabbits based on toxicology studies was estimated after each vaccination and the final blood sample. All three pathways produced elevated levels of circulating anti-LPS IgG (data not shown). The maximum response was obtained 14 days following a single IM injection of a 100 pg dose of 1790GAHB. For the IN voice, the maximum antibody response required two immunizations. The circulating anti-LPS IgG levels 14 days after the final vaccination were not significantly different from the rate obtained with the IM administration of the 100 pg dose of 17 90GAHB. Vaccination with 10 pg by the ID route also gave an increased response with BE2016 / 5444 subsequent vaccinations (Spearman rank test p <0.0001) but the effect was less pronounced than with the IN route. The final circulating anti-LPS IgG levels were significantly higher by the ID route compared to the IM route (t test of antibodies transformed into log p = 0.002). Phase I clinical trial with S. sonnei 1790GAHB This clinical trial was performed to assess the safety and immunogenicity of 3 doses of a candidate vaccine against Shigella sonnei (1790GAHB vaccine) when given at different dosages in healthy adults (18 to 45 years at enrollment). The safety profile of the 1790GAHB vaccine is evaluated compared to that of placebo (GAHBPlacebo), consisting of a suspension of aluminum hydroxide having the same concentration as the vaccine formulations of the study. The subjects were randomized to receive three vaccinations, four weeks apart, either from the 1790GAHB vaccine (at five concentrations of the antigen) or from the GAHB placebo. Producing strain Shigella sonnei containing the following genetic modifications: AtolR: breaks the bond between the inner and outer membrane to give a large amount of outer membrane blebs (GMMA); AhtrB: to reduce the cited reactogen of LPS; virG nadA / B knock-in (activation): stabilizes the virulence plasmid encoding the O antigen (AgO). Maximum amount per 0.5 ml dose (i.m.) 100 pg of GMMA protein 6.1 pg AgO BE2016 / 5444 0.35 mg of aluminum as ALHYDROGEL® In isotonic physiological serum buffered with Tris Placebo per 0.5 ml dose (i.m.) 0.35 mg of aluminum as ALHYDROGEL® In isotonic physiological serum buffered with Tris Lower doses for administration prepared by diluting the maximum dose in placebo Injection volume: i.m. : 0.5 ml Cohort Way Dose (AgO /Proteins) 1790GAHBNb of subjects PlaceboNb of subjects Estimateimmunological AT IM 0.061 / 1 pg 8 2 Serum IgG B IM 0.31 / 5 pg 8 2 VS IM 1.4 / 25 pg 8 2 D IM 3.0 / 50 pg 8 2 E IM 6.1 / 100 pg 8 2 All doses of 1790GAHB were well tolerated and the safety data support the use of L 100 pg of 1790GAHB proteins when administered by the IM route. The serological estimate indicates that sufficient serum levels of S. sonnei anti-LPS IgG are triggered one month after the first, second and third vaccination in subjects receiving 25 pg, 50 pg and 100 pg of 1790GAHB (figure 2 (a) and (b)). The median level of antibodies in these groups is higher than that observed in the convalescent serum. These data support the use of 1790GAHB as a GMMA vaccine for S. sonnei and a combination of four to six different GMMAs in one BE2016 / 5444 multivalent formulation, assuming reactogenicity-immunogenicity profiles similar to 1790GAHB. Estimation of the immunogenicity of the multivalent Shigella (I) vaccine in mice In this study, a multivalent GMMA-based Shigella vaccine was tested, specifically a formulation of ALHYDROGEL® containing GMMA from the 4 most prevalent serotypes of the GEMS study, S. sonnei, and S. flexneri 2a, 3a , and 6. For this purpose, the production of GMMA by strains of S. flexneri was amplified by the deletion of tolR as in S. sonnei and the reactogenicity of LPS was reduced by genetic modification of lipid A via the deletion of htrB gene. A formulation of ALHYDROGEL® was chosen for the tetravalent formulation and the simple formulations of GMMA based on experience with 1790GAHB in rabbits that adsorption on aluminum hydroxide increases tolerance. This study was the first immunogenicity study for S. flexneri serotypes. The formulations were prepared based on the protein content as it was used for the 1790GAHB. Based on biochemical characterization, the GMMAs of S. flexneri 2a contain approximately 10 times more AgO per mg of protein than the 1790-GMMAs. Thus, a starting concentration 10 times lower than that in the power study of the regular 1790GAHB (29 ng, see above) was chosen. Similar doses have been established for the GMMAs of S. flexneri 3a and the GMMAs of S. flexneri 6. The response to AgO with a BE2016 / 5444 only GMMA formulation (S. sonnei or S. flexneri 2a, 3a or 6) was compared to the response to the same AgO triggered by the tetravalent formula. The strong immunogenicity of all the components included in the tetravalent formulation will provide proof of the concept of immunogenicity for a multivalent formulation and will support another development of a multivalent formulation of AgO-GMMA. In the tetravalent formula, each of the components is present at the same concentration as in the simple formulations described above. Thus, the total protein content of the tetravalent formulation is 160 pg / ml. For the tetravalent formulation, the GMMAs of S. sonnei, the GMMAs of S. flexneri 2a, the GMMAs of S. flexneri 3a and the GMMAs of S. flexneri 6 are mixed at the same concentration and then formulated with hydroxide. aluminum as specified above. The GAHB ALHYDROGEL® diluent placebo contained: ALHYDROGEL® in physiological saline buffered with Tris at the same concentrations as in 1790GAHB (ALHYDROGEL® 0.7 mg Al 3+ / ml, 10 mM Tris, pH 7.4, 9 g / 1 sodium chloride). Immunization BALB / c mice (8 per group) were immunized intraperitoneally on day 0 with 4 different doses of the formulations, as described in the table below. One group was immunized with the diluent ALHYDROGEL® (GAHB-Placebo) as a control. All formulations were tested for bacterial contamination before immunization. Briefly, 50 μΐ of each formulation were deposited on LB agar plates in triplicate and after 24 h of incubation at 37 ° C., the plates were examined for growth. Only formulations without any bacterial growth were used for immunization. BE2016 / 5444 No. ofgroup No. ofmouse Antigen name Dosage ofThe antigen(protein) Adjuvant (0.35 mg Al 3+ per dose) VPA Way 1 1-8 S. sonnei (1790GÄHB) 2 ng Alhydrogel 500 μΐ IP 2 9-16 S. flexneri 2a 2 ng Alhydrogel 500 μΐ IP 3 17-24 S. flexneri 3a 2 ng Alhydrogel 500 μΐ IP 4 25-32 S. flexneri 6 2 ng Alhydrogel 500 μΐ IP 5 33-40 Combinationtetravalente 8 ng Alhydrogel 500 μΐ IP 6 41-48 S. sonnei (1790GAHB) 20 ng Alhydrogel 500 μΐ IP 7 49-56 S. flexneri 2a 20 ng Alhydrogel 500 μΐ IP 8 57-64 S. flexneri 3a 20 ng Alhydrogel 500 μΐ IP 9 65-72 S. flexneri 6 20 ng Alhydrogel 500 μΐ IP 10 73-80 Combinationtetravalent 80 ng Alhydrogel 500 μΐ IP 11 81-88 S. sonnei (1790GAHB) 200 ng Alhydrogel 500 μΐ IP 12 89-96 S. flexneri 2a 200 ng Alhydrogel 500 μΐ IP 13 97-104 S. flexneri 3a 200 ng Alhydrogel 500 μΐ IP 14 105-112 S. flexneri 6 200 ng Alhydrogel 500 μΐ IP 15 113-120 Combinationtetravalent 800 ng Alhydrogel 500 μΐ IP 16 121-128 S. sonnei (1790GAHB) 2000 ng Alhydrogel 500 μΐ IP 17 129-136 S. flexneri 2a 2000 ng Alhydrogel 500 μΐ IP 18 137-144 S. flexneri 3a 2000 ng Alhydrogel 500 μΐ IP 19 145-152 S. flexneri 6 2000 ng Alhydrogel 500 μΐ IP 20 153-160 Combinationtetravalent 8000 ng Alhydrogel 500 μΐ IP 21 161-168 GAHB-Placebo - Alhydrogel 500 μΐ IP Blood sample for serology: blood was obtained on day 21 from all animals, sera BE2016 / 5444 were collected and the sera were stored at 2 to 8 ° C until the test. ELISA test ELISA tests were carried out to determine the anti-LPS antibody levels of S. sonnei, anti-AgO of S. flexneri 2a, anti-AgO of S. flexneri 3a, anti-AgO of S. flexneri 6 of immunized mice respectively with GMMAs formulated with ALHYDROGEL® coming from S. sonnei, S. flexneri 2a, S. flexneri 3a and S. flexneri 6 administered alone or as part of a tetravalent vaccine. The results for S. sonnei, S. flexneri 2a and S. flexneri 3a are presented in Figures 3 and 4. Mice immunized with increasing concentrations of 1790GAHB developed specific anti-LPS antibodies to S. sonnei (measured in ELISA units) which gave a significant Spearman rank with P <0.0001 (alpha = 0.05) and a correlation coefficient of 0.86, mice immunized with increasing concentrations of the tetravalent formulation developed specific anti-LPS antibodies to S. sonnei (measured in ELISA units) with a significant Spearman rank with P <0.0001 ( alpha = 0.05) and a correlation coefficient of 0.86. Mice immunized with increasing concentrations of S. flexneri 3a developed specific anti-AgO antibodies to S. flexneri 3a with a significant Spearman rank with P <0.0001 (alpha = 0.05) and a correlation coefficient of 0.84. Similarly, mice immunized with increasing concentrations of the formulation BE2016 / 5444 tetravalente developed specific anti-AgO antibodies to S. flexneri 3a OAg with a significant Spearman rank with P <0.0001 (alpha = 0.05) and a correlation coefficient of 0.73. The anti-AgO DO ELISA of S. flexneri 2a antibodies obtained with the sera of mice immunized with increasing concentrations of S. flexneri 2a gave a significant Spearman rank with P <0.0001 (alpha = 0.05) and a correlation coefficient of 0.75. In addition, mice immunized with increasing concentrations of the tetravalent formulation developed anti-AgO antibodies to S. flexneri 2a which exhibited a significant Spearman rank with P <0.0001 (alpha = 0.05) and a coefficient correlation of 0.75. The results of the comparisons of the respective dose-response curves are shown in Figure 4. No significant difference was observed between them for any specific response of a serovar between the simple formulation of GMMA and the formulation tetravalent indicating that there at had no interference. FACS analysis Antisera produced against the formulation tetravalente of GMMA recognized the S. sonnei, S. flexneri 2a, S. flexneri 3a and S. flexneri 6 wild type. While the antisera produced against individual GMMAs recognized the homologous bacterial strain. Conclusions The serum antibody response to the specific Shigella serovar triggered by the formulation BE2016 / 5444 tetravalent of Shigella was not different from the individual components. Thus, there is no evidence of interference. Multivalent Shigella (II) vaccine A multivalent GMMA vaccine from Shigella is exemplified, specifically a formulation of ALHYDROGEL® containing GMMA from S. sonnei, and S. flexneri lb, 2a, 3a, and 6. The production of GMMA by the strains of S. flexneri is amplified by the deletion of tolR as in S. sonnei and the reactogenicity of the LPS is reduced by genetic modification of lipid A via the deletion of the gene either msbB or htrB. As before, a formulation of ALHYDROGEL® is chosen for the pentavalent formulation and the simple formulations of GMMA based on experience with 17 90GAHB in rabbits that adsorption on aluminum hydroxide enhances tolerance. In the pentavalent formulation, each of the components is present at the same concentration as in the simple formulations described beforehand. For the pentavalent formulation, the GMMAs of S. sonnei, the GMMAs of S. flexneri lb, the GMMAs of S. flexneri 2a, the GMMAs of S. flexneri 3a and the GMMAs of S. flexneri 6 are mixed at the same concentrations and then formulated with aluminum hydroxide as specified above. Multivalent Shigella (III) vaccine A multivalent GMMA Shigella vaccine is exemplified, specifically a formulation of BE2016 / 5444 ALHYDROGEL® containing GMMA from S. sonnei, and S. flexneri lb, 2a, 2b, 3a, and 6. The production of GMMA by the strains of S. flexneri is amplified by the deletion of tolR as in S. sonnei and the reactogenicity of the LPS is reduced by genetic modification of lipid A via the deletion of the gene either msbB or htrB. As before, a formulation of ALHYDROGEL® is chosen for the hexavalent formulation and the simple formulations of GMMA based on experience with 1790GAHB in rabbits that adsorption on aluminum hydroxide increases tolerance. In the hexavalent formulation, each of the components is present at the same concentration of proteins or of AgO as in the simple formulations described beforehand. For the hexavalent formulation, the GMMA of S. sonnei, the GMMA of S. flexneri lb, the GMMA of S. flexneri 2a, the GMMA of S. flexneri 2b, the GMMA of S. flexneri 3a and the GMMA of S. flexneri 6 are mixed at the same concentrations and then formulated with aluminum hydroxide as specified above. Specific combinations A) An immunogenic composition comprising (a) GMMAs purified from a mutant of Shigella sonnei 53G AtolR, AhtrB, virG:: nacLAB, (b) GMMAs purified from a mutant of Shigella flexneri 2a 2457T AtolR, AmsbBl, (c) GMMAs purified from a mutant of Shigella flexneri 3a 6885 AtolR, AmsbBl, (c) GMMAs purified from a mutant of Shigella flexneri 6 BE2016 / 5444 10.8537 AtolR, AhtrB AmsbBl and (e) an aluminum adjuvant, in which the GMMAs comprise a modified lipid A and in which the strains of Shigella flexneri are devoid of the virulence plasmid. B) An immunogenic composition comprising (a) GMMAs purified from a mutant of Shigella sonnei 53G AtolR, AhtrB, virG:: nadAB, (b) GMMAs purified from Shigella flexneri 2a 2457T AtolR, AmsbBl, (c ) GMMAs purified from a mutant of Shigella flexneri 3a 6885 AtolR, AmsbBl, (d) GMMAs purified from a mutant of Shigella flexneri 6 10.8537 AtolR, AmsbBl, (e) GMMAs purified from a mutant of Shigella flexneri lb STANSFIELD AtolR, AmsbBl and (f) an aluminum adjuvant, in which the GMMA include a lipid A and in which the strains of Shigella flexneri are devoid of the virulence plasmid. C) An immunogenic composition comprising (a) GMMAs purified from a mutant of Shigella sonnei 53G AtolR, AhtrB, virG:: nadAB, (b) GMMAs purified from a mutant of Shigella flexneri 2a 2457T AtolR, AmsbBl, (c) GMMAs purified from a mutant of Shigella flexneri 3a 6885 AtolR, AmsbBl, (c) GMMAs purified from a mutant of Shigella flexneri 6 10.8537 AtolR, AmsbBl, (e) GMMAs purified from a mutant of Shigella flexneri 2b 69/50 AtolR, AmsbBl and (f) an aluminum adjuvant, in which the GMMAs comprise a lipid A and in which the strains of Shigella flexneri lack the virulence plasmid. BE2016 / 5444 D) An immunogenic composition comprising (a) GMMAs purified from a mutant of Shigella sonnei 53G AtolR, AhtrB, virG :: nadAB, (b) GMMAs purified from a mutant of Shigella flexneri 2a 2457T AtolR, AmsbBl, (c) GMMAs purified from a mutant of Shigella flexneri 3a 6885 AtolR, AmsbBl, (c) GMMAs purified from a mutant of Shigella flexneri 6 10.8537 AtolR, AmsbBl, (e) GMMA purified from a mutant of Shigella flexneri lb STANSFIELD AtolR, AmsbBl, (f) GMMA purified from a mutant of Shigella flexneri 2b 69/50 AtolR, AmsbBl and ( g) an aluminum adjuvant, in which the GMMAs comprise a lipid A and in which the strains of Shigella flexneri are devoid of the virulence plasmid. E) The immunogenic composition of (A), (B), (C) or (D) in which the adjuvant is aluminum hydroxide, for example, ALHYDROGEL®. F) The immunogenic composition of any one of (A), (B), (C), (D) or (E) which comprises at least one or more pharmaceutical carriers and / or excipients. G) The immunogenic composition of F which is a pharmaceutical or vaccine composition. H) The pharmaceutical or vaccine composition of G for use in the prevention or treatment of Shigella infection in an animal, particularly a human. While certain embodiments of the present invention have been described and exemplified specifically above, it is not intended that the invention is limited to such embodiments BE2016 / 5444 Various modifications may deviate from the scope and spirit of the invention as presented in the following. made without the present claims BE2016 / 5444 References 1. Murray CJ, Vos T, Lozano R, Naghavi M, Flaxman AD, Michaud C, et al. Disability-adjusted life years (DALYs) for 291 diseases and injuries in 21 regions, 1990-2010: a systematic analysis for the Global Burden of Disease Study 2010. Lancet. 2012; 380: 2197-2223. 2. Lozano R, Naghavi M, Foreman K, Lim S, Shibuya K, Aboyans V, et al. Global and regional mortality from 235 causes of death for 20 age groups in 1990 and 2010: a systematic analysis for the Global Burden of Disease Study 2010. Lancet. 2012; 380: 2095-2128. 3. Kotloff KL, Nataro JP, Blackwelder WC, Nasrin D, Farag TH, Panchalingam S, et al. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): a prospective, case-control study. Lancet. 2013, -382: 209-222. 4. Livio S, Strockbine NA, Panchalingam S, Tennant SM, Barry EM, Marohn ME, et al. Shigella isolates from the global enteric multicenter study inform vaccine development. Clin Infect Dis. 2014, -59: 933-941. 5. Levine MM, Kotloff KL, Barry EM, Pasetti MF, Sztein MB. Clinical trials of Shigella vaccines: two steps forward and one step back on a long, hard road. Nat Rev Microbiol. 2007, -5: 540-553. 6. Chang Z, Lu S, Chen L, Jin Q, Yang J. Causative species and serotypes of shigellosis in mainland China: systematic review and meta-analysis. PLoS One. 2012, -7: e52515. BE2016 / 5444 7. Vinh. H, Nhu NTK, Nga TVT, Duy PT, Campbell JI, Hoang NVM, et al. A changing picture of shigellosis in southern Vietnam: shifting species dominance, antimicrobial susceptibility and clinical presentation. BMC Infect Dis. 2009, -9: 204. 8. Kweon, 2008 Curr Opin Infect Dis. 21 (3): 313-8. 9. Cohen D, Ashkenazi S, Green MS, Gdalevich M, Robin G, Slepon R, et al. Double-blind vaccinecontrolled randomized efficacy trial of an investigational Shigella sonnei conjugate vaccine in young adults. Lancet. 1997; 349: 155-159. 10. Passwell JH, Ashkenzi S, Banet-Levi Y, RamonSaraf R, Farzam N, Lerner-Geva L, et al. Age-related efficacy of Shigella O-specific polysaccharide conjugates in 1-4-year-old Israeli children. Vaccinated. 2010, -28: 2231-2235. 11. Susanna Esposito, Roman Prymula, Gian Vincenzo Zuccotti, Fang Xie, Michelangelo Barone, Peter M Dull, Daniela Toneatto, A phase II randomized controlled trial of a multicomponent meningococcal serogroup B vaccine, 4CMenB, in infants (II). Human Vaccines & Immunotherapeutics Vol. 10, Iss. 7, 2014. 12. Erlandson and Mackey (1958) J Bacteriol 75 (3): 253-7. 13. US 5,681,736. 14. Uyttendaele et al. (2001) International journal of food microbiology 70 (3): 255-65. 15. Formal SB, Kent TH, May HC, Palmer A, Falkow S, LaBrec EH. Protection of monkeys against experimental shigellosis with a living attenuated oral polyvalent dysentery vaccine. J Bacteriol. 1966, -92: 17-22. BE2016 / 5444 16. Makino S, Sasakawa C, Kamata K, Kurata T, Yoshikawa M. A genetic determinant required for continuous reinfection of adjacent cells on large plasmid in S. flexneri 2a. Cell. 1986, -46: 551-555. 17. Berlanda Scorza F, Colucci AM, Maggiore L, Sanzone S, Rossi O, Ferlenghi I, et al. High yield production process for Shigella outer membrane particles. PLoS One. 2012; 7: e35616. 18. Plum A-L, Schuch R, Fernandez RE, Mumy KL, Kohler H, McCormick BA, et al. nadA and nadB of Shigella flexneri 5a are antivirulence loci responsible for the synthesis of quinolinate, a small molecule inhibitor of Shigella pathogenicity. Microbiology. 2007, -153: 23632372. 19. Clementz T, Bednarski JJ, Raetz CR. Function of the htrB high temperature requirement gene of Escherchia coli in the acylation of lipid A. J Biol Chem. 1996, -271: 12095-12102. 20. Rossi 0, Pesce I, Giannelli C, Aprea S, Caboni M, Citiulo F, et al. Modulation of Endotoxicity of Shigella Generalized Modules for Membrane Antigens (GMMA) by Genetic Lipid A Modifications: Relative Activation of TLR4 and TLR2 Pathways in Different Mutants. J Biol Chem. 2014; 289: 24922-24935. 21. Micoli F, Rondini S, Gavini M, Pisoni I, Lanzilao L, Colucci AM, et al. A scalable method for 0antigen purification applied to various Salmonella serovars. Anal Biochem. 2013; 434: 136-145. 22. Robbins JB, Kubler-Kielb J, Vinogradov E, Mocca C, Pozsgay V, Shiloach J, et al. Synthesis, characterization, and immunogenicity in mice of BE2016 / 5444 Shigella sonnei O-specific oligosaccharide-core-protein conjugates. Proc Natl Acad Sci USA. 2009; 106: 79747978. 23. Westphal 0, Jann K. Bacterial lipopolysaccharides: extraction with phenol-water and further application of the procedure. 1965; 5: 83-91. 24. Stoddard MB, Pinto V, Keizer PB, Zollinger W. Evaluation of a whole-blood cytokine release assay for use in measuring endotoxin activity of group B Neisseria meningitidis vaccines made from lipid A acylation mutants. Clin Vaccine Immunol. 2010; 17: 98107. 25. Pyrogens. In: European Pharmacopoeia. 8th ed. Strasbourg, Cedex: Directorate for the Quality of Medicines & Healthcare of the Council of Europe (EDQM). 2013. chapter 2.6.8. 26. Moscardo E, Maurin A, Dorigatti R, Champeroux P, Richard S. An optimized methodology for the neurobehavioral assessment in rodents. J Pharmacol Toxicol Methods. 2007, -56: 239-255. 27. Jiang Y, Yang F, Zhang X, Yang J, Chen L, Yan Y, et al. The complete sequence and analysis of the large virulence plasmid pSS of Shigella sonnei. Plasmid 2005, -54: 149-159. 28. Rossi 0, Maggiore L, Necchi F, Koeberling 0, MacLennan CA, Saul A, et al. Comparison of Colorimetric Assays with Quantitative Amino Acid Analysis for Protein Quantification of Generalized Modules for Membrane Antigens (GMMA). Mol Biotechnol. 2014; in press 29. [A]. Maggiore L, Yu L, Omasits U, Rossi 0, Dougan G, Thomson NR, Saul A, Choudhary JS, Gerke C. BE2016 / 5444 Quantitative proteomic analysis of Shigella flexneri and Shigella sonnei Generalized Modules for Membrane Antigens (GMMA) reveals highly pure preparations. Int J Med Microbiol. 2016 Feb; 306 (2): 99-108 30. [B]. Christiane Gerke, Anna Maria Colucci, Carlo Giannelli, Silvia Sanzone, Claudia Giorgina Vitali, Luigi Sollai, Omar Rossi, Laura B. Martin, Jochen Auerbach, Vito Di Cioccio, Allan Saul. Production of a Shigella sonnei Vaccine Based on Generalized Modules for Membrane Antigens (GMMA), 1790GAHB. 31. PLoS One. 2015; 10 (8): e013447831. Zhu D, Huang S, Gebregeorgis E, McClellan H, Dai W, Miller L, Saul A. Development of a Direct ALHYDROGEL®Formulation Immunoassay (DAFIA). J Immunol Methods. 2009 May 15, -344 (1): 73-8 32. Datsenko et al. (Proc Natl Acad Sci USA. 2000 Jun 6; 97 (12): 6640-5. BE2016 / 5444
权利要求:
Claims (15) [1] 1. Immunogenic composition comprising (a) purified GMMAs from Shigella sonnei, (b) purified GMMAs from Shigella flexneri and (c) an adjuvant, in which the GMMAs comprise a modified lipid A. [2] 2. The immunogenic composition according to claim 1, in which the modified lipid A is a penta-acylated lipid A. [3] 3. Immunogenic composition according to claim 1 or 2, in which the GMMAs of Shigella flexneri are purified from at least one strain chosen from the group consisting of 2a, 3a and 6. [4] 4. Immunogenic composition according to claim 3, the immunogenic composition comprising GMMAs of Shigella flexneri purified from each of strains 2a, 3a and 6. [5] 5. Immunogenic composition according to claim 4, in which the GMMAs are purified from (a) Shigella sonnei AtolR, AhtrB, virG :: nadAB, (b) Shigella flexneri 2a AtolR, AmsbB or Shigella flexneri 2a AtolR, AhtrB, ( c) Shigella flexneri 3a AtolR, AmsbB or Shigella flexneri 3a AtolR, AhtrB and (d) Shigella flexneri 6 AtolR, AmsbB or Shigella flexneri 6 AtolR, AhtrB. [6] 6. Immunogenic composition according to any one of the preceding claims, in which the strain of S. sonnei is S. sonnei 53G. [7] 7. Immunogenic composition according to any one of claims 1 to 6, in which the strain (s) of S. flexneri are chosen from the group BE2016 / 5444 consisting of S. flexneri 2457T (2a), S. flexneri 6885 (3a) and S. flexneri 10.8537 (6). [8] 8. Immunogenic composition according to any one of claims 3 to 7, said composition comprising at least one other strain of Shigella flexneri chosen from the group consisting of lb and 2b. [9] 9. Immunogenic composition according to claim 8, in which the other or other strains of Shigella flexneri are chosen from the group consisting of S. flexneri STANSFIELD (serotype lb) and S. flexneri 69/50 (serotype 2b). [10] 10. The immunogenic composition of claim 4, wherein at least two of the four types of GMMA are present in a ratio of 1/4 to 4/1. [11] 11. Immunogenic composition according to any one of the preceding claims, in which the adjuvant is aluminum hydroxide. [12] The immunogenic composition according to any one of the preceding claims, wherein at least 75% of the GMMAs have a diameter in the range of 25 nm to 40 nm. [13] 13. Immunogenic composition according to any one of the preceding claims, said composition comprising at least one or more pharmaceutical carriers and / or excipients. [14] 14. Immunogenic composition according to claim 13, said composition being a pharmaceutical or vaccine composition. [15] 15. Pharmaceutical or vaccine composition according to claim 14 for use in the BE2016 / 5444 prevention or treatment of Shigella infection in an animal, particularly a human. to be BE2016 / 5444 Temperature increase after injection (° C) Time after injection (hours)
类似技术:
公开号 | 公开日 | 专利标题 US20200384096A1|2020-12-10|Immunogenic compositions Mann et al.2009|Lipid vesicle size of an oral influenza vaccine delivery vehicle influences the Th1/Th2 bias in the immune response and protection against infection BE1022345A9|2016-11-16|USPA2 PROTEIN CONSTRUCTS AND USES THEREOF BE1024465B1|2018-03-05|VACCINE JP5503543B2|2014-05-28|Pharmaceutical composition containing Clostridium difficile toxoid A and B Keiser et al.2010|A phase 1 study of a group B meningococcal native outer membrane vesicle vaccine made from a strain with deleted lpxL2 and synX and stable expression of opcA AU2016312422A1|2018-03-29|Methods and compositions for immune protection against extra-intestinal pathogenic E. coli TW201945028A|2019-12-01|Multivalent pneumococcal polysaccharide-protein conjugate composition TW201934140A|2019-09-01|Multivalent pneumococcal polysaccharide-protein conjugate composition BE1022744B1|2016-08-29|MUTANT STAPHYLOCOCCAL ANTIGENS BE1025210B1|2018-12-12|IMMUNOGENIC CONJUGATES AND THEIR USE BE1024361A1|2018-01-30|IMMUNOGENIC COMPOSITION BE1021315B1|2015-10-28|NEW COMPOSITIONS BE1022174B1|2016-02-24|VACCINE BE1022949B1|2016-10-21|IMMUNOGENIC COMPOSITION EP2653164A1|2013-10-23|Type 5 and type 8 capsular polysaccharides of over-productive strains of S. aureus BE1025443A1|2019-02-21|NOMV-ANTIGEN CONJUGATES AND THEIR USE EP2429658B1|2016-04-20|Method for adjuvating the lipopolysaccharide | of gram-negative bacteria JP6152944B2|2017-06-28|Bound immunogenic composition and uses thereof BE1024794B1|2018-07-10|IMMUNOGENIC COMPOSITIONS BE1025119B1|2018-11-05|NOVEL METHODS FOR INDUCING AN IMMUNE RESPONSE Autenrieth et al.2008|Yersinia enterocolitica: subversion of adaptive immunity and implications for vaccine development BE1024160B9|2017-12-06|IMMUNOGENIC FORMULATION CA2761924C|2017-10-31|Menigococcus vaccine containing lipooligosaccharide | from modified strains of l6 immunotype neisseria meningitidis BE1022857B1|2016-09-27|IMMUNIZATION AGAINST STAPHYLOCOCCUS AUREUS
同族专利:
公开号 | 公开日 MX2017016401A|2018-03-02| AR105010A1|2017-08-30| JP2018517729A|2018-07-05| CN107921116A|2018-04-17| US20200384096A1|2020-12-10| CA2989242A1|2016-12-22| EP3310381A1|2018-04-25| WO2016202872A1|2016-12-22| US20180169206A1|2018-06-21| BE1024284A1|2018-01-12| JP2021167317A|2021-10-21| JP6930927B2|2021-09-01|
引用文献:
公开号 | 申请日 | 公开日 | 申请人 | 专利标题 WO2012049662A1|2010-10-15|2012-04-19|Novartis Vaccines Institute For Global Health Srl|Hyperblebbing salmonella strains| WO2014192031A1|2013-05-31|2014-12-04|Indian Council Of Medical Research|A multi-serotype outer membrane vesicles of shigellae as a novel candidate vaccine| US5679564A|1994-10-05|1997-10-21|Antex Biologics, Inc.|Methods for producing enhanced antigenic campylobacter bacteria and vaccines| GB0917002D0|2009-09-28|2009-11-11|Novartis Vaccines Inst For Global Health Srl|Improved shigella blebs| CN103933559B|2014-04-29|2016-08-17|北京智飞绿竹生物制药有限公司|Shigella multivalence combined vaccine|GB201712824D0|2017-08-10|2017-09-27|Glaxosmithkline Biologicals Sa|Multi-functionalized nOMV Conjugates| JP2021519789A|2018-04-03|2021-08-12|ユニバーシティ オブ メリーランド，ボルチモア|Enhanced Shigella polyvalent-toxinogenic E. coli vaccine| EP3808372A1|2019-10-17|2021-04-21|GlaxoSmithKline Biologicals S.A.|Novel vaccine compositions|
法律状态:
2018-02-22| FG| Patent granted|Effective date: 20180115 |
优先权:
[返回顶部]
申请号 | 申请日 | 专利标题 EP15020097.0|2015-06-16| EP15020097|2015-06-16| 相关专利
Sulfonates, polymers, resist compositions and patterning process
Washing machine
Washing machine
Device for fixture finishing and tension adjusting of membrane
Structure for Equipping Band in a Plane Cathode Ray Tube
Process for preparation of 7 alpha-carboxyl 9, 11-epoxy steroids and intermediates useful therein an
国家/地区
|